SubtiBank SubtiBank
cwlJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cwlJ

spore coat protein, cell wall hydrolase
locus
BSU02600
pI
9.35
mw
16.22 kDa
protein length
142 aa Sequence Blast
gene length
429 bp Sequence Blast
function
spore germination
product
spore coat protein, cell wall hydrolase
essential
no
synonyms
ycbQ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.3|Class III]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • Gene

    Coordinates
    282,469 282,897

    The protein

    Protein family

  • cwlJ family (according to Swiss-Prot)
  • [SW|Localization]

  • outer edge of the spore cortex [Pubmed|12177332]
  • inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|49ED84B48CEC09493B6056D03D2A57578770CE15|cwlJ]
    description
    [Pubmed|9515903]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|9515903,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [SW|SpoIIID]) [Pubmed|15383836,9515903,15699190]
  • view in new tab

    Biological materials

    Mutant

  • 1G19 ( ''cwlJ''::''tet''), [Pubmed|11466292], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1G19&Search=1G19 BGSC]
  • BKE02600 ([gene|49ED84B48CEC09493B6056D03D2A57578770CE15|cwlJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACGTCACCTCCCCTTG, downstream forward: _UP4_TAGAGACAGGACACCGTTCA
  • BKK02600 ([gene|49ED84B48CEC09493B6056D03D2A57578770CE15|cwlJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACGTCACCTCCCCTTG, downstream forward: _UP4_TAGAGACAGGACACCGTTCA
  • References

    Reviews

  • 23202530
  • Original publications

  • 16936016,11807087,9515903,15699190,15317760,11466292,20435722,12177332,23543708,23746146,15383836,22171814,26187959