SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


two-component response regulator, regulation of the [gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]-[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|search|liaR ]operon in response to bacitracin
22.98 kDa
protein length
211 aa Sequence Blast
gene length
636 bp Sequence Blast
regulation of the [gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]-[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|search|liaR ]operon
two-component response regulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    3,394,422 3,395,057

    The protein

    Catalyzed reaction/ biological activity

  • regulation of the ''[gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]-[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]'' operon in response to bacitracin
  • Paralogous protein(s)

  • [protein|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|YhcZ], [protein|EFEAF09E4449A022A7323450FDED9458426A0080|YdfI], [protein|23F365C23BDEE02D42C9355FC7D2A65DAF9F79ED|YxjL], [protein|387EF370CE24F7A3C20789A57329A02EBED46F53|LnrK]
  • [SW|Domains]

  • [SW|Response regulatory domain] (aa 3-119) (according to UniProt)
  • [SW|HTH luxR-type domain] (aa 143-208) (according to UniProt)
  • Modification

  • phosphorylation on a Asp residue by [protein|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|LiaS]
  • Structure

  • [PDB|5HEV] ([protein|search|LiaR ]from Enterococcus faecium, 62% identity) [pubmed|27670715]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15273097], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]: activation, [Pubmed|16816187], in [regulon|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR regulon]
  • regulation

  • ''[protein|search|liaG]'': constitutive
  • view in new tab



  • ''[protein|search|liaG]'': constitutive
  • view in new tab

    Biological materials


  • MGNA-B034 (yvqC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33080 ([gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCCATTCTGACCATTTCAT, downstream forward: _UP4_AATCATCTCGTGAATTAGGC
  • BKK33080 ([gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCCATTCTGACCATTTCAT, downstream forward: _UP4_AATCATCTCGTGAATTAGGC
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • References


  • 27344142
  • Original publications

  • 18394148,19164152,15273097,17921301,10094672,19164157,14651641,17600057,17660417,16816187,15101989,17660417,20057163,20817675,20639339,23279150,22964256,22092710,23326432,27791134,27856233,27670715,29185696,,30848888