SubtiBank SubtiBank
ilvH [2018-07-16 13:08:14]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ilvH [2018-07-16 13:08:14]

acetolactate synthase (small subunit)
locus
BSU28300
pI
10.30
mw
19.31 kDa
protein length
174 aa Sequence Blast
gene length
522 bp Sequence Blast
function
biosynthesis of branched-chain amino acids
product
acetolactate synthase (small subunit)
essential
no
ec
2.2.1.6
synonyms
ilvN

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.12|Biosynthesis/ acquisition of branched-chain amino acids]
  • Gene

    Coordinates
    2,894,733 → 2,895,251

    The protein

    Catalyzed reaction/ biological activity

  • 2 pyruvate = 2-acetolactate + CO2 (according to Swiss-Prot)
  • Protein family

  • acetolactate synthase small subunit family (according to Swiss-Prot)
  • Structure

  • [PDB|2F1F] (regulatory subunit from ''Escherichia coli'', 37% identity, 62% similarity) [Pubmed|16458324]
  • Expression and Regulation

    Operons

    genes
    [gene|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|ilvB]-[gene|49E2D2EE480C2FFDED0C35E3AF0DBED5AD819B5F|ilvH]-[gene|EC1CB2FD563EFDA391D13EB8ADFDC8C9734E9D57|ilvC]-[gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA]-[gene|105E3452D7F142A7D7616E35AF3FB753C9B63E38|leuB]-[gene|AC459429A9C50463FD947C1CF9EA919B6FE3B335|leuC]-[gene|0EB4C6EE398B14B9284FFAEDBC26C866CE2070D7|leuD]
    description
    [Pubmed|1577690]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1577690], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: termination/antitermination, via tRNA controlled [SW|RNA switch], repression by BCAA, in [regulon|T-box|T-box]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|15547269], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: activation, [Pubmed|12193635], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expression is stimulated in the presence of glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [PubMed|12193635]
  • additional information

  • An [SW|ncRNA|antisense RNA] is predicted for [gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA] [PubMed|20525796]
  • the [SW|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE28300 (Δ[gene|49E2D2EE480C2FFDED0C35E3AF0DBED5AD819B5F|ilvH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGTCAATGTGATAATTC, downstream forward: _UP4_TAAAACATAACAAGGGAGAG
  • BKK28300 (Δ[gene|49E2D2EE480C2FFDED0C35E3AF0DBED5AD819B5F|ilvH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGTCAATGTGATAATTC, downstream forward: _UP4_TAAAACATAACAAGGGAGAG
  • References

  • 15060025,12193635,19258532,8289305,18641142,15547269,12618455,12107147,20935095,25157083,24163341,25755103,26220295