SubtiBank SubtiBank
mleN
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

mleN

malate-H+/Na+-lactate antiporter
locus
BSU_23560
pI
7.25
mw
50.05 kDa
protein length
468 aa Sequence Blast
gene length
1407 bp Sequence Blast
function
malate uptake
product
malate-H+/Na+-lactate antiporter
essential
no
synonyms
yqkI

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.4|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,452,800 2,454,206

    Phenotypes of a mutant

  • abrupt arrest in the mid-logarithmic phase of growth on malate when low concentrations of protonophore were present [Pubmed|10903309]
  • The protein

    Protein family

  • NhaC Na(+)/H(+) (TC 2.A.35) antiporter family (with [protein|A7F1B4C0D32E18773170BFBEEB94E5EF55C7DB97|NhaC], according to UniProt)
  • Paralogous protein(s)

  • [protein|A7F1B4C0D32E18773170BFBEEB94E5EF55C7DB97|NhaC]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|49DF23B8E19658DB32835B6D23DD21E4BF481B20|mleN]-[gene|160EBB7885D7C7FD30A6E35605A862C156E2DA80|mleA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1711029], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|146947C974D62BCB282BA3F5B924B35695D75886|AnsR]: repression, [Pubmed|11914346], in [regulon|146947C974D62BCB282BA3F5B924B35695D75886|AnsR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • ''[protein|search|ansA]'': expressed in the presence of asparagine ([protein|search|AnsR]) [Pubmed|11914346]
  • view in new tab

    genes
    [gene|FED8E46AA1C4EFD27796D5DFBBB1663EBF336BFD|ansA]-[gene|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|ansB]-[gene|49DF23B8E19658DB32835B6D23DD21E4BF481B20|mleN]-[gene|160EBB7885D7C7FD30A6E35605A862C156E2DA80|mleA]
    description
    [Pubmed|22383849]

    regulation

  • ''[protein|search|ansA]'': expressed in the presence of asparagine ([protein|search|AnsR]) [Pubmed|11914346]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C411 (yqkI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2409 NBRP B. subtilis, Japan]
  • GP1460 (''mleN''::''spc''), available in [SW|Jörg Stülke]'s lab
  • BKE23560 ([gene|49DF23B8E19658DB32835B6D23DD21E4BF481B20|mleN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGAAGTCCCCCTTCAT, downstream forward: _UP4_GGCTAATAGGGGAGGATCAC
  • BKK23560 ([gene|49DF23B8E19658DB32835B6D23DD21E4BF481B20|mleN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGAAGTCCCCCTTCAT, downstream forward: _UP4_GGCTAATAGGGGAGGATCAC
  • lacZ fusion

  • pGP388 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • References

  • 18763711,10903309,22900538,22383849,1711029,11914346