SubtiBank SubtiBank
maf
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

maf

nucleotide pyrophosphatase, [SW|cell division] inhibitor in competent cells, blocks septation during the escape from competence, required for the stability of [protein|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|ComGA]
locus
BSU_28050
pI
5.71
mw
21.15 kDa
protein length
189 aa Sequence Blast
gene length
570 bp Sequence Blast
function
cell division control
product
nucleotide pyrophosphatase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    Coordinates
    2,862,572 2,863,141

    The protein

    Catalyzed reaction/ biological activity

  • nucleotide pyrophosphatase [Pubmed|24210219]
  • dTTP + H2O --> diphosphate + dTMP + H+ (according to UniPort)
  • H2O + UTP --> diphosphate + H+ + UMP (according to UniPort)
  • CTP + H2O --> CMP + diphosphate + H+ (according to UniPort)
  • H2O + ψ-UTP --> diphosphate + H+ + ψ-UMP (according to UniPort)
  • 5-methyl-CTP + H2O --> 5-methyl-CMP + diphosphate + H+ (according to UniPort)
  • 5-methyl-UTP + H2O --> 5-methyl-UMP + diphosphate + H+ (according to UniPort)
  • Protein family

  • maf family (single member, according to UniProt)
  • [SW|Cofactors]

  • binds phosphorylated compounds (UTP, IMP, IDP, GDP and others) in ''in vitro'' experiments
  • Structure

  • [PDB|1EX2] [Pubmed|10841541]
  • [SW|Localization]

  • cytosolic protein [Pubmed|24164455]
  • near the poles of competent cells [Pubmed|21564336]
  • Expression and Regulation

    Operons

    genes
    [gene|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|maf]-[gene|2BD11D71AA6D9EFAD8A209C8813CC8B059180C84|radC]-[gene|A4C8719E06F774A6EB4D79757CC79CF89E453A54|mreB]-[gene|6A14D0C7FD94A838BAB3B74AA100EA678F1E4E34|mreC]-[gene|231C30963AFB863424C087CB722446D319976D65|mreD]-[gene|8C94C9598A823A8405B3E1FA0124E21D90845B8E|minC]-[gene|37DAD42A391E2FC506225EAF91B8F21629A401DF|minD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, promoter p2 within [protein|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|Maf] [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, promoter p1, upstream of [protein|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|Maf] [Pubmed|26091431], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11948146,11918817,21564336], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • constitutively expressed [Pubmed|23701187]
  • view in new tab

    Biological materials

    Mutant

  • BKE28050 ([gene|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|maf]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCGTCATCCTTTCAG, downstream forward: _UP4_TGACGGTTCTATAAACGGGA
  • References

    Reviews

  • 21595759
  • Original publications

  • 21564336,10841541,8387996,11948146,24164455,21926231,24210219,22383849,26091431