SubtiBank SubtiBank
cotG [2019-11-14 11:43:54]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cotG [2019-11-14 11:43:54]

outer spore coat protein
23.81 kDa
protein length
195 aa Sequence Blast
gene length
588 bp Sequence Blast
resistance of the spore
spore coat protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Class V]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    3,717,238 3,717,825

    The protein

    Catalyzed reaction/ biological activity

  • required for the maturation of [protein|2A0B2CA7C982C03C1AFBDB3540A918EE937B06CB|CotB] [Pubmed|26953338]
  • Modification

  • phosphorylated on Ser-15, Ser-39, and Thr-147 by [protein|D53067098F693669F61E5CCF6C06664580C40C79|CotH] [Pubmed|27185916,25115591]
  • [SW|Localization]

  • outer spore coat, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,7814326], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|7814326], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR]: activation, [Pubmed|15621419], in [regulon|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|15383836,15699190,7814326]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab

    Biological materials


  • BKE36070 ([gene|49BAFE3E69F1F91AEF4154F55B44639DD3CE4A71|cotG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTGAAATCCTCCTTTT, downstream forward: _UP4_TAATCTAAGTTTTCATTGTT
  • BKK36070 ([gene|49BAFE3E69F1F91AEF4154F55B44639DD3CE4A71|cotG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTGAAATCCTCCTTTT, downstream forward: _UP4_TAATCTAAGTTTTCATTGTT
  • References

  • 12884008,7814326,9573176,14762006,15699190,15621419,22171814,21984783,15383836,25115591,26953338,27185916,30088242