SubtiBank SubtiBank
cotG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cotG

outer spore coat protein
locus
BSU36070
pI
10.67
mw
23.81 kDa
protein length
195 aa Sequence Blast
gene length
588 bp Sequence Blast
function
resistance of the spore
product
spore coat protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.5|Class V]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    Coordinates
    3,717,238 3,717,825

    The protein

    Catalyzed reaction/ biological activity

  • required for the maturation of [protein|2A0B2CA7C982C03C1AFBDB3540A918EE937B06CB|CotB] [Pubmed|26953338]
  • Modification

  • phosphorylated on Ser-15, Ser-39, and Thr-147 by [protein|D53067098F693669F61E5CCF6C06664580C40C79|CotH] [Pubmed|27185916,25115591]
  • [SW|Localization]

  • outer spore coat, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|49BAFE3E69F1F91AEF4154F55B44639DD3CE4A71|cotG]
    description
    [Pubmed|7814326]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,7814326], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|7814326], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR]: activation, [Pubmed|15621419], in [regulon|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|15383836,15699190,7814326]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • BKE36070 ([gene|49BAFE3E69F1F91AEF4154F55B44639DD3CE4A71|cotG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTGAAATCCTCCTTTT, downstream forward: _UP4_TAATCTAAGTTTTCATTGTT
  • BKK36070 ([gene|49BAFE3E69F1F91AEF4154F55B44639DD3CE4A71|cotG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTGAAATCCTCCTTTT, downstream forward: _UP4_TAATCTAAGTTTTCATTGTT
  • References

  • 12884008,7814326,9573176,14762006,15699190,15621419,22171814,21984783,15383836,25115591,26953338,27185916,30088242