SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


outer spore coat protein
23.81 kDa
protein length
195 aa Sequence Blast
gene length
588 bp Sequence Blast
resistance of the spore
spore coat protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Class V]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    3,717,238 3,717,825

    The protein

    Catalyzed reaction/ biological activity

  • required for the maturation of [protein|2A0B2CA7C982C03C1AFBDB3540A918EE937B06CB|CotB] [Pubmed|26953338]
  • Modification

  • phosphorylated on Ser-15, Ser-39, and Thr-147 by [protein|D53067098F693669F61E5CCF6C06664580C40C79|CotH] [Pubmed|27185916,25115591]
  • [SW|Localization]

  • outer spore coat, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,7814326], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|7814326], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR]: activation, [Pubmed|15621419], in [regulon|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|15383836,15699190,7814326]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab

    Biological materials


  • BKE36070 ([gene|49BAFE3E69F1F91AEF4154F55B44639DD3CE4A71|cotG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTGAAATCCTCCTTTT, downstream forward: _UP4_TAATCTAAGTTTTCATTGTT
  • BKK36070 ([gene|49BAFE3E69F1F91AEF4154F55B44639DD3CE4A71|cotG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTGAAATCCTCCTTTT, downstream forward: _UP4_TAATCTAAGTTTTCATTGTT
  • References

  • 12884008,7814326,9573176,14762006,15699190,15621419,22171814,21984783,15383836,25115591,26953338,27185916,30088242,31713316,32592201