SubtiBank SubtiBank
lytA [2019-02-22 16:04:05]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

lytA [2019-02-22 16:04:05]

secretion of major autolysin LytC
locus
BSU35640
pI
4.06
mw
11.09 kDa
protein length
102 aa Sequence Blast
gene length
309 bp Sequence Blast
function
autolysis
product
secretion of major autolysin LytC
essential
no
synonyms
lppX

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,662,789 3,663,097

    The protein

    [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|497C9654DC7514FF738D18E1F083299C43003A4C|lytA]-[gene|E1F9922DF7273040F84E5AC207A9F4CAFB85DC75|lytB]-[gene|6A21293823151C6980BF52B31A4B249A8440F2E1|lytC]
    description
    [Pubmed|1357079]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1357079], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|1357079], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: repression, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR]: repression, (in complex with [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]) [Pubmed|20351052], in [regulon|920F91E748EE079FF864011D9052B073567C41E4|SlrR regulon]
  • view in new tab

    Biological materials

    Mutant

  • 1A789 ( ''lytA''::''kan''), [Pubmed|1588906], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A789&Search=1A789 BGSC]
  • BKE35640 ([gene|497C9654DC7514FF738D18E1F083299C43003A4C|lytA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTTCACCTCATTAT, downstream forward: _UP4_TAAGATATAGGGAGGAACCT
  • BKK35640 ([gene|497C9654DC7514FF738D18E1F083299C43003A4C|lytA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTTCACCTCATTAT, downstream forward: _UP4_TAAGATATAGGGAGGAACCT
  • References

  • 16306698,20351052,1357079,9158733