SubtiBank SubtiBank
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website


part of haem translocase, required for cytochrome c synthesis
61.59 kDa
protein length
542 aa Sequence Blast
gene length
1629 bp Sequence Blast
cytochrome c biogenesis
part of the [protein|495721E4B8BF6FEC01E62E86339560F90776EED1|ResB]-[protein|97FE84CF968596AC39D19EE2E43DA625147FD702|ResC] haem translocase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW|Respiration/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,419,179 2,420,807

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • haem-binding protein, translocation of haem from the cytoplasmic to the extracytoplasmic site of the membrane [Pubmed|19682263]
  • [SW|Localization]

  • cell membrane [protein|495721E4B8BF6FEC01E62E86339560F90776EED1|ResB]-[protein|97FE84CF968596AC39D19EE2E43DA625147FD702|ResC] [Pubmed|19682263]
  • Expression and Regulation


    view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8631715], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [PubMed|8631715,11222591], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9988472], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|16825793], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [,11222591 PubMed]
  • view in new tab

    Biological materials


  • BKE23140 ([gene|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCGCATTCACATTTGACTT, downstream forward: _UP4_AAATAGGCGAAAAGGGAGTG
  • BKK23140 ([gene|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCGCATTCACATTTGACTT, downstream forward: _UP4_AAATAGGCGAAAAGGGAGTG
  • References

  • 19682263,10844653,8631715,8631715,11222591,9988472,16825793,28189581