SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


ATP synthase, part of the F1 complex (subunit gamma)
31.50 kDa
protein length
287 aa Sequence Blast
gene length
864 bp Sequence Blast
ATP synthesis
ATP synthase (subunit gamma)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.5|ATP synthesis] → [category|SW|ATPase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,782,938 3,783,801

    The protein

    Catalyzed reaction/ biological activity

  • ATP synthesis [ see a video]
  • Protein family

  • ATPase gamma chain family (single member, according to UniProt)
  • Effectors of protein activity

  • ATPase activity is inhibited upon binding of Mg-ADP to [protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|AtpD] [pubmed|30580998]
  • Structure

  • [PDB|4XD7] (from ''Geobacillus kaustophilus'', 69% identity) [Pubmed|26032434]
  • [SW|Localization]

  • membrane, peripheral via theF0 complex
  • Expression and Regulation



    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • the mRNA is processed between [gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI] and [gene|CC1894D90AC17487A286B2909964916825055F93|atpB] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials


  • BKE36820 ([gene|492EEC8068043DA770F5DC1D54799C4366AE9A01|atpG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGATTTCACCACCTTTT, downstream forward: _UP4_TAGAAAGATTTTGTCAGGAG
  • BKK36820 ([gene|492EEC8068043DA770F5DC1D54799C4366AE9A01|atpG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGATTTCACCACCTTTT, downstream forward: _UP4_TAGAAAGATTTTGTCAGGAG
  • References


  • 23356252,23341301,23267178,22822068,21524994,19489730,17208001,16730323
  • Original publications

  • 7961438,26032434,30580998