SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


anthranilate synthase (subunit I)
57.95 kDa
protein length
515 aa Sequence Blast
gene length
1548 bp Sequence Blast
biosynthesis of tryptophan
anthranilate synthase (subunit I)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    2,375,869 2,377,416

    The protein

    Catalyzed reaction/ biological activity

  • Chorismate L-glutamine = anthranilate pyruvate L-glutamate (according to Swiss-Prot)
  • Effectors of protein activity

  • subject to feedback inhibtion by tryptophan [Pubmed|4956345]
  • Structure

  • [PDB|1I7Q] (from ''Serratia marcescens'', 42% identity, 62% similarity) [Pubmed|11371633]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab


    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • BKE22680 ([gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTCTCACTCCTTATG, downstream forward: _UP4_GCTGATGAACAGATTTCTAC
  • BKK22680 ([gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTCTCACTCCTTATG, downstream forward: _UP4_GCTGATGAACAGATTTCTAC
  • References


  • 19385727,16285852,12966138
  • The ''trpE'' [SW|RNA switch]

  • 20384694,19033375,17881743,7515880,2422155,3133360,7678334,7592410,14976255,2422155,8419914,1551827,16285852,10714985,11566991,12963367,14712717,21097886,24505391,24682818,29794222
  • Other original publications

  • 4956345,3924737,6436812,21815947