SubtiBank SubtiBank
trpE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

trpE

anthranilate synthase (subunit I)
locus
BSU22680
pI
5.25
mw
57.95 kDa
protein length
515 aa Sequence Blast
gene length
1548 bp Sequence Blast
function
biosynthesis of tryptophan
product
anthranilate synthase (subunit I)
essential
no
ec
4.1.3.27
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    Coordinates
    2,375,869 2,377,416

    The protein

    Catalyzed reaction/ biological activity

  • Chorismate L-glutamine = anthranilate pyruvate L-glutamate (according to Swiss-Prot)
  • Protein family

  • Anthranilate synthase component I family (with [protein|B189AD3E3D18876E1956763182D835A151727392|PabB], according to UniProt)
  • Effectors of protein activity

  • subject to feedback inhibtion by tryptophan [Pubmed|4956345]
  • Structure

  • [PDB|1I7Q] (from ''Serratia marcescens'', 42% identity, 62% similarity) [Pubmed|11371633]
  • Expression and Regulation

    Operons

    genes
    [gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    genes
    [gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]-[gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • BKE22680 ([gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTCTCACTCCTTATG, downstream forward: _UP4_GCTGATGAACAGATTTCTAC
  • BKK22680 ([gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTCTCACTCCTTATG, downstream forward: _UP4_GCTGATGAACAGATTTCTAC
  • References

    Reviews

  • 19385727,16285852,12966138
  • The ''trpE'' [SW|RNA switch]

  • 20384694,19033375,17881743,7515880,2422155,3133360,7678334,7592410,14976255,2422155,8419914,1551827,16285852,10714985,11566991,12963367,14712717,21097886,24505391,24682818,29794222
  • Other original publications

  • 4956345,3924737,6436812,21815947