SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


DNA-dependent ATPase, recombination factor, involved in processing recombination intermediates at replication forks
46.35 kDa
protein length
421 aa Sequence Blast
gene length
1266 bp Sequence Blast
control of the access of the replication machinery to a collapsed replication fork
[protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] accessory protein, DNA-dependent ATPase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    2,812,336 2,813,601

    Phenotypes of a mutant

  • sensitive to H2O2 [pubmed|30954900]
  • reduced viability of [gene|48BCA38E609E443406E03A32D2BB8DA2E9915A71|rarA] [gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA] or [gene|48BCA38E609E443406E03A32D2BB8DA2E9915A71|rarA] [gene|80E6F156764FF30300D034EE6FB44F2DB8338AF3|recO] double mutants [pubmed|32117122]
  • The protein

    Catalyzed reaction/ biological activity

  • inhibits [protein|AF5ADDA2A98EC18BB72A81AA0336E639C0D1F430|PriA]-dependent initiation of [category|SW 3.1.1|DNA replication] [pubmed|29947798]
  • contributes to error-prone DNA repair, links re-initiation of DNA replication with repair-by-recombination by controlling the access of the replication machinery to a collapsed replication fork [pubmed|30954900]
  • contributes to the assembly of RecA nucleoprotein filaments onto single-stranded DNA [pubmed|32117122]
  • Protein family

  • [SW|AAA ATPase family] (according to UniProt)
  • Effectors of protein activity

  • ATPase is stimulated by ssDNAdsDNA junctions or dsDNA ends [pubmed|29947798]
  • ssDNA-dependent ATPase is stimulated by [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA] bound to ssDNA [pubmed|29947798]
  • Structure

  • [PDB|3PVS] (from E. coli, 39% identity) [pubmed|21297161]
  • additional information

  • for the corresponding ''E. coli'' protein, RarA, see [ RarA]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A827 (yrvN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27530 ([gene|48BCA38E609E443406E03A32D2BB8DA2E9915A71|rarA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATCATCTCTCCTTAC, downstream forward: _UP4_TAAAACAAAAAAACAGCCTT
  • BKK27530 ([gene|48BCA38E609E443406E03A32D2BB8DA2E9915A71|rarA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATCATCTCTCCTTAC, downstream forward: _UP4_TAAAACAAAAAAACAGCCTT
  • References

  • 21170359,21297161,29947798,30971308,30954900,32117122