SubtiBank SubtiBank
rarA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rarA

DNA-dependent ATPase, recombination factor, involved in processing recombination intermediates at replication forks
locus
BSU_27530
pI
6.80
mw
46.35 kDa
protein length
421 aa Sequence Blast
gene length
1266 bp Sequence Blast
function
control of the access of the replication machinery to a collapsed replication fork
product
DNA-dependent ATPase, recombination factor
essential
no
synonyms
yrvN

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    2,812,336 2,813,601

    Phenotypes of a mutant

  • sensitive to H2O2 [pubmed|30954900]
  • The protein

    Catalyzed reaction/ biological activity

  • inhibits [protein|AF5ADDA2A98EC18BB72A81AA0336E639C0D1F430|PriA]-dependent initiation of [category|SW 3.1.1|DNA replication] [pubmed|29947798]
  • contributes to error-prone DNA repair, links re-initiation of DNA replication with repair-by-recombination by controlling the access of the replication machinery to a collapsed replication fork [pubmed|30954900]
  • Protein family

  • [SW|AAA ATPase family] (according to UniProt)
  • Effectors of protein activity

  • ATPase is stimulated by ssDNAdsDNA junctions or dsDNA ends [pubmed|29947798]
  • ssDNA-dependent ATPase is stimulated by [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA] bound to ssDNA [pubmed|29947798]
  • Structure

  • [PDB|3PVS] (from E. coli, 39% identity) [pubmed|21297161]
  • additional information

  • for the corresponding ''E. coli'' protein, RarA, see [http://ecoliwiki.net/colipedia/index.php/rarA RarA]
  • Expression and Regulation

    Operons

    genes
    [gene|48BCA38E609E443406E03A32D2BB8DA2E9915A71|rarA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A827 (yrvN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/827 NBRP B. subtilis, Japan]
  • BKE27530 ([gene|48BCA38E609E443406E03A32D2BB8DA2E9915A71|rarA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATCATCTCTCCTTAC, downstream forward: _UP4_TAAAACAAAAAAACAGCCTT
  • BKK27530 ([gene|48BCA38E609E443406E03A32D2BB8DA2E9915A71|rarA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATCATCTCTCCTTAC, downstream forward: _UP4_TAAAACAAAAAAACAGCCTT
  • References

  • 21170359,21297161,29947798,30971308,30954900