SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


49.20 kDa
protein length
451 aa Sequence Blast
gene length
1356 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,844,416 3,845,771

    The protein


  • [PDB|1L0Q] (from Methanosarcina mazei, corresponds to aa 124 ... 357, 29% identity) [pubmed|12377130]
  • [SW|Localization]

  • Variable (Spotty) [Pubmed|16479537]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A523 (ywhK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37450 ([gene|48AFD558E71531CDBDC3983B36702819D1548E63|ywhK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTTCACTTCCTTTTC, downstream forward: _UP4_TAACCGCTGCATGTTGTGCA
  • BKK37450 ([gene|48AFD558E71531CDBDC3983B36702819D1548E63|ywhK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTTCACTTCCTTTTC, downstream forward: _UP4_TAACCGCTGCATGTTGTGCA
  • References

  • 12073041,16479537,12377130