SubtiBank SubtiBank
ywhK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywhK

unknown
locus
BSU_37450
pI
3.75
mw
49.20 kDa
protein length
451 aa Sequence Blast
gene length
1356 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,844,416 3,845,771

    The protein

    Structure

  • [PDB|1L0Q] (from Methanosarcina mazei, corresponds to aa 124 ... 357, 29% identity) [pubmed|12377130]
  • [SW|Localization]

  • Variable (Spotty) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|48AFD558E71531CDBDC3983B36702819D1548E63|ywhK]-[gene|E9B2B4E505209AC9A6EA9EF5F7707E7405DC5335|ywhL]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A523 (ywhK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/523 NBRP B. subtilis, Japan]
  • BKE37450 ([gene|48AFD558E71531CDBDC3983B36702819D1548E63|ywhK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTTCACTTCCTTTTC, downstream forward: _UP4_TAACCGCTGCATGTTGTGCA
  • BKK37450 ([gene|48AFD558E71531CDBDC3983B36702819D1548E63|ywhK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTTCACTTCCTTTTC, downstream forward: _UP4_TAACCGCTGCATGTTGTGCA
  • References

  • 12073041,16479537,12377130