SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


chaperone for the export of [protein|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|flagellin]
14.99 kDa
protein length
133 aa Sequence Blast
gene length
402 bp Sequence Blast
[category|SW 4.1.1|Motility and chemotaxis]
chaperone for [protein|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|flagellin] export

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • Gene

    3,632,488 3,632,889

    The protein

    Catalyzed reaction/ biological activity

  • prevents premature assembly of [protein|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|Hag] [Pubmed|26490009]
  • Protein family

  • FliS family (single member, according to UniProt)
  • Structure

  • [PDB|1VH6] [Pubmed|16021622]
  • [PDB|6GOW] (complex with flagellin) [Pubmed|30068950]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab


    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8195064], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials


  • BKE35330 ([gene|4882FAD988FEDD0E72E4CAFB10C8DE61DDAC23B0|fliS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTCATCCTCCAAATT, downstream forward: _UP4_CGGCACGGATCAGGCGGGAT
  • BKK35330 ([gene|4882FAD988FEDD0E72E4CAFB10C8DE61DDAC23B0|fliS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTCATCCTCCAAATT, downstream forward: _UP4_CGGCACGGATCAGGCGGGAT
  • References


  • 26490009
  • Original publications

  • 8195064,20534509,8195064,23144244,29061663,16021622,30068950