SubtiBank SubtiBank
yhaZ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhaZ

similar to alkyl purine DNA glycosylase
locus
BSU_09810
pI
9.08
mw
41.65 kDa
protein length
357 aa Sequence Blast
gene length
1074 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    1,055,143 1,056,216

    The protein

    Structure

  • [PDB|5VHV] (from Pseudomonas flourescens, 41% identity) [pubmed|29054852]
  • Expression and Regulation

    Operons

    genes
    [gene|4873DC24E73F5677AF5C4947B21199904C3EB394|yhaZ]
    description
    [Pubmed|16267290]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|search|LexA]) [Pubmed|16267290]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yhaZ]' and '[protein|search|yhaX]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A677 (yhaZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/677 NBRP B. subtilis, Japan]
  • BKE09810 ([gene|4873DC24E73F5677AF5C4947B21199904C3EB394|yhaZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAACACCGCTTTTTC, downstream forward: _UP4_TGAGTGAATAAAAAATCCCT
  • BKK09810 ([gene|4873DC24E73F5677AF5C4947B21199904C3EB394|yhaZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAACACCGCTTTTTC, downstream forward: _UP4_TGAGTGAATAAAAAATCCCT
  • References

    Reviews

  • 22933559
  • Original publications

  • 16267290,20525796,29054852