SubtiBank SubtiBank
ytcI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytcI

similar to acetate-CoA ligase
locus
BSU_29560
pI
6.18
mw
59.40 kDa
protein length
529 aa Sequence Blast
gene length
1590 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,023,677 3,025,266

    The protein

    Protein family

  • [SW|ATP-dependent AMP-binding enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|6671E7D85E99D349679F0E9D825DC035D10FFD2E|AcsA]:
  • Structure

  • [PDB|3ETC] (from Methanosarcina Acetivorans 37% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|48538F67259B25B64A7BC4263E944C7074E8E1B3|ytcI]-[gene|DF51B9E50BD6C87C5FD1A48E15F281FC3A096D0A|ytcJ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A107 (ytcI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/107 NBRP B. subtilis, Japan]
  • BKE29560 ([gene|48538F67259B25B64A7BC4263E944C7074E8E1B3|ytcI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAACAACTCCTCACTTT, downstream forward: _UP4_GCGTAAAGAAAGAGAGTGAA
  • BKK29560 ([gene|48538F67259B25B64A7BC4263E944C7074E8E1B3|ytcI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAACAACTCCTCACTTT, downstream forward: _UP4_GCGTAAAGAAAGAGAGTGAA