SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to acetate-CoA ligase
59.40 kDa
protein length
529 aa Sequence Blast
gene length
1590 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    3,023,677 3,025,266

    The protein

    Protein family

  • [SW|ATP-dependent AMP-binding enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|6671E7D85E99D349679F0E9D825DC035D10FFD2E|AcsA]:
  • Structure

  • [PDB|3ETC] (from Methanosarcina Acetivorans 37% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A107 (ytcI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29560 ([gene|48538F67259B25B64A7BC4263E944C7074E8E1B3|ytcI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAACAACTCCTCACTTT, downstream forward: _UP4_GCGTAAAGAAAGAGAGTGAA
  • BKK29560 ([gene|48538F67259B25B64A7BC4263E944C7074E8E1B3|ytcI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAACAACTCCTCACTTT, downstream forward: _UP4_GCGTAAAGAAAGAGAGTGAA