SubtiBank SubtiBank
yteT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yteT

unknown
locus
BSU_30100
pI
5.72
mw
48.73 kDa
protein length
428 aa Sequence Blast
gene length
1287 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    3,079,333 3,080,619

    The protein

    Protein family

  • [SW|Gfo/Idh/MocA family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|7DFE74C751A67CCC84579D52005E1399B0A10166|IolW], [protein|920C5750CB95102B073C32874D512E8D636D2C7D|IolU], [protein|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|IolG], [protein|942BAE9FA023DFCA06B6D26A856A72F2979E23FA|YrbE], [protein|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|IolX], [protein|03BE6DA854612B3F6741E0E167AB310F0DE96285|YfiI], [protein|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|NtdC]
  • Expression and Regulation

    Operons

    genes
    [gene|4ED1DD17694A06CFDFF48943BAE8AEC2CCCB0401|yteP]-[gene|40787292458E5C6676F9F4F6F34C0D6BD5313DE1|yteR]-[gene|1482FD92CB6DC966263F08AD109769728FC708E4|yteS]-[gene|484D17480DFAD3667E0EBC6D38854A7546A8DB46|yteT]-[gene|103A912E971E5760DBA45CC0681D77CED61D1FED|yteU]-[gene|FCAE9513D764B7A9AAB9C59E6CE1D65C400D4B44|yteV]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A813 (yteT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/813 NBRP B. subtilis, Japan]
  • BKE30100 ([gene|484D17480DFAD3667E0EBC6D38854A7546A8DB46|yteT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATGTTCTTCAATATCCTCA, downstream forward: _UP4_TAATGCAAAAAAGGAGGGGG
  • BKK30100 ([gene|484D17480DFAD3667E0EBC6D38854A7546A8DB46|yteT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATGTTCTTCAATATCCTCA, downstream forward: _UP4_TAATGCAAAAAAGGAGGGGG
  • References

  • 17449691