SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


3-hydroxyacyl-CoA dehydrogenase (acetoacetyl-CoA)
89.96 kDa
protein length
815 aa Sequence Blast
gene length
2448 bp Sequence Blast
fatty acid degradation
3-hydroxyacyl-CoA dehydrogenase (acetoacetyl-CoA)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW|Utilization of fatty acids]
  • Gene

    3,370,025 3,372,472

    The protein

    Catalyzed reaction/ biological activity

  • (3S)-hydroxyacyl-CoA + NAD+ --> 3-oxoacyl-CoA + H+ + NADH (according to UniProt)
  • Protein family

  • 3-hydroxyacyl-CoA dehydrogenase family (with [protein|FB95ABDC8557F26525E8B211595C130A7203ABC0|MmgB], according to UniProt)
  • [SW|Cofactors]

  • FMN or FAD [Pubmed|21635694]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17189250], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR]: activation, [Pubmed|12817086], in [regulon|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR regulon]
  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|21398533], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • ''[protein|4787161A022E938A6D58A505D92369F889C7DE04|FadN]'': induced by long-chain fatty acids ([protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]) [Pubmed|17189250]
  • expression of the operon is induced during [SW|biofilm formation] [pubmed|31113899]
  • view in new tab


    regulatory mechanism

  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • [protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR]: activation, [Pubmed|12817086], in [regulon|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR regulon]
  • regulation

  • ''[protein|search|fadM]'': induced by long-chain fatty acids ([protein|search|FadR]) [Pubmed|17189250]
  • view in new tab

    Biological materials


  • MGNA-A604 (yusL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32840 ([gene|4787161A022E938A6D58A505D92369F889C7DE04|fadN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGATATCCCCCTTGAA, downstream forward: _UP4_CCTTTACGGAATTAGGAGGG
  • BKK32840 ([gene|4787161A022E938A6D58A505D92369F889C7DE04|fadN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGATATCCCCCTTGAA, downstream forward: _UP4_CCTTTACGGAATTAGGAGGG
  • References

  • 12817086,12850135,17189250,17919287,23033921,21398533,31113899