SubtiBank SubtiBank
yckD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yckD

unknown
locus
BSU_03400
pI
10.09
mw
12.65 kDa
protein length
110 aa Sequence Blast
gene length
333 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    369,773 370,105

    Expression and Regulation

    Operons

    genes
    [gene|4765B305F31765445D9F5EB0D6EDED5B38DED084|yckD]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE03400 ([gene|4765B305F31765445D9F5EB0D6EDED5B38DED084|yckD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCATTTTATTCCTCCAA, downstream forward: _UP4_TAAGATTTTAAGCATCCAAT
  • BKK03400 ([gene|4765B305F31765445D9F5EB0D6EDED5B38DED084|yckD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCATTTTATTCCTCCAA, downstream forward: _UP4_TAAGATTTTAAGCATCCAAT
  • References

  • 15699190,16497325