SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


petrobactin (3.4-catecholate siderophore) [SW|ABC transporter] (ATP-binding protein)
28.33 kDa
protein length
252 aa Sequence Blast
gene length
759 bp Sequence Blast
acquisition of iron
petrobactin [SW|ABC transporter] (ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    434,256 435,014

    The protein

    Catalyzed reaction/ biological activity

  • uptake of the siderophore petrobactin [Pubmed|19955416]
  • Fe(III)-siderophore + ATP + H2O --> Fe(III)-siderophore + ADP + H+ + phosphate (according to UniProt)
  • Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|5C52DB31F378E49AABE5D937DD901A68F3810477|YusV], [protein|E70BE74D5AB4B06CDFF902E58A0B9EBF477E21EC|FhuC], [protein|E76640F895261DA34AD2342B54B43D11857AEA9A|FecF]
  • Structure

  • [PDB|4YMS] (amino acid transporter from Caldanaerobacter subterraneus, 31% identity) [pubmed|25848002]
  • [SW|Localization]

  • associated to the membrane (via [protein|552D4C42DCEA4625000160D2625711C61AB11661|FpbN]-[protein|EC63B5CDFDB4DF3A967ECEC40F2C44849311148B|FpbO]) [Pubmed|10092453]
  • Expression and Regulation



    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|29133393,12354229]
  • view in new tab

    Biological materials


  • MGNA-C011 (yclP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03820 ([gene|473628F86C18FE9957841F3C8B45242C90CB341D|fpbP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGTTTGCTTACATTTCTGA, downstream forward: _UP4_TAATATATAGAAGAGGTGAG
  • BKK03820 ([gene|473628F86C18FE9957841F3C8B45242C90CB341D|fpbP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGTTTGCTTACATTTCTGA, downstream forward: _UP4_TAATATATAGAAGAGGTGAG
  • References

  • 10092453,19955416,12354229,25848002,29133393