SubtiBank SubtiBank
yosM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yosM

putative SPbeta phage subunit of nucleoside diphosphate reductase
locus
BSU_20070
pI
7.26
mw
14.51 kDa
protein length
129 aa Sequence Blast
gene length
390 bp Sequence Blast
function
unknown
product
putative SPbeta phage subunit of nucleoside diphosphate reductase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,165,577 2,165,966

    The protein

    Protein family

  • nrdI family (with [protein|1EA0595C74359A36B9161CFD531CA894C5E66E25|NrdI], according to UniProt)
  • Paralogous protein(s)

  • [protein|1EA0595C74359A36B9161CFD531CA894C5E66E25|NrdI]
  • Structure

  • [PDB|2XOD] (from Bacillus Anthracis 47% identity)
  • Biological materials

    Mutant

  • BKE20070 ([gene|47098DA18DBD3FEF9E33D21677B6D94D5B0ACB2B|yosM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTACTCTCATATGTAATGA, downstream forward: _UP4_AAAATCATTCAGGAGGTACA
  • BKK20070 ([gene|47098DA18DBD3FEF9E33D21677B6D94D5B0ACB2B|yosM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTACTCTCATATGTAATGA, downstream forward: _UP4_AAAATCATTCAGGAGGTACA