SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative SPbeta phage subunit of nucleoside diphosphate reductase
14.51 kDa
protein length
129 aa Sequence Blast
gene length
390 bp Sequence Blast
putative SPbeta phage subunit of nucleoside diphosphate reductase

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    2,165,577 2,165,966

    The protein

    Protein family

  • nrdI family (with [protein|1EA0595C74359A36B9161CFD531CA894C5E66E25|NrdI], according to UniProt)
  • Paralogous protein(s)

  • [protein|1EA0595C74359A36B9161CFD531CA894C5E66E25|NrdI]
  • Structure

  • [PDB|2XOD] (from Bacillus Anthracis 47% identity)
  • Biological materials


  • BKE20070 ([gene|47098DA18DBD3FEF9E33D21677B6D94D5B0ACB2B|yosM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTACTCTCATATGTAATGA, downstream forward: _UP4_AAAATCATTCAGGAGGTACA
  • BKK20070 ([gene|47098DA18DBD3FEF9E33D21677B6D94D5B0ACB2B|yosM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTACTCTCATATGTAATGA, downstream forward: _UP4_AAAATCATTCAGGAGGTACA