SubtiBank SubtiBank
yvqK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvqK

ATP:cob(I)alamin adenosyltransferase
locus
BSU_33150
pI
5.21
mw
21.34 kDa
protein length
193 aa Sequence Blast
gene length
582 bp Sequence Blast
function
unknown
product
ATP:cob(I)alamin adenosyltransferase
essential
no
ec
2.5.1.17
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.13|Biosynthesis/ acquisition of cobalamine (B12))]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,400,537 3,401,118

    The protein

    Catalyzed reaction/ biological activity

  • 2 ATP + 2 cob(II)yrinate a,c diamide + reduced [electron-transfer flavoprotein] --> 2 adenosylcob(III)yrinate a,c-diamide + 3 H+ + oxidized [electron-transfer flavoprotein] + 2 triphosphate (according to UniProt)
  • 2 ATP + 2 cob(II)alamin + reduced [electron-transfer flavoprotein] --> 2 adenosylcob(III)alamin + 3 H+ + oxidized [electron-transfer flavoprotein] + 2 triphosphate (according to UniProt)
  • Protein family

  • Cob(I)alamin adenosyltransferase family (single member, according to UniProt)
  • Structure

  • [PDB|1RTY]
  • Expression and Regulation

    Operons

    genes
    [gene|C76265F521D9A153F28AC6BACD935CC20DEA5D9C|yvrC]-[gene|1DC4A3D7E93677B0EAD15F43C80E50FD98527EBC|yvrB]-[gene|128EBAE9C14C7BB75173DF912853A6FCE86ABCE4|yvrA]-[gene|468D9141EAC78556C9F6C564875F70EC43E60C1C|yvqK]

    regulatory mechanism

  • [regulon|B12 riboswitch|B12 riboswitch]: termination, upon binding of B12 [Pubmed|14704351], in [regulon|B12 riboswitch|B12 riboswitch]
  • regulation

  • expression is decreased in the presence of cobalamin (vitamin B12) ([SW|B12 riboswitch]) [Pubmed|14704351]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B042 (yvqK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1041 NBRP B. subtilis, Japan]
  • BKE33150 ([gene|468D9141EAC78556C9F6C564875F70EC43E60C1C|yvqK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCCTGAATCTCCTTTA, downstream forward: _UP4_TAAAAAGTGAAAAGGAAAGC
  • BKK33150 ([gene|468D9141EAC78556C9F6C564875F70EC43E60C1C|yvqK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCCTGAATCTCCTTTA, downstream forward: _UP4_TAAAAAGTGAAAAGGAAAGC
  • References

  • 17588214,14704351