SubtiBank SubtiBank
rapD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rapD

response regulator aspartate phosphatase, controls [protein|search|ComA ]activity
locus
BSU_36380
pI
7.69
mw
41.98 kDa
protein length
354 aa Sequence Blast
gene length
1065 bp Sequence Blast
function
control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]-dependent gene expression
product
response regulator aspartate phosphatase
essential
no
synonyms
ywpA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.2|Response regulator aspartate phosphatase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    3,744,349 3,745,413

    The protein

    Catalyzed reaction/ biological activity

  • control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]-dependent gene expression [Pubmed|17227471]
  • Protein family

  • [SW|RAP family] (according to UniProt)
  • [SW|Domains]

  • six [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
  • Structure

  • [PDB|4I9E] ([protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|RapF], 26% identity) [pubmed|23526880]
  • Expression and Regulation

    Operons

    genes
    [gene|4670F7C4CB9084A5BA478CAE238FA0F8C39F3A7E|rapD]
    description
    [Pubmed|9636707]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9636707], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|9636707], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR]: repression, [Pubmed|17227471], in [regulon|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR regulon]
  • regulation

  • repressed by [protein|search|RghR] [Pubmed|17227471]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A079 (rapD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/79 NBRP B. subtilis, Japan]
  • BKE36380 ([gene|4670F7C4CB9084A5BA478CAE238FA0F8C39F3A7E|rapD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCCTACCTCTTTGCT, downstream forward: _UP4_TGATTGAAAAACGCCCATTT
  • BKK36380 ([gene|4670F7C4CB9084A5BA478CAE238FA0F8C39F3A7E|rapD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCCTACCTCTTTGCT, downstream forward: _UP4_TGATTGAAAAACGCCCATTT
  • References

  • 17227471,9636707,18179421,23526880