SubtiBank SubtiBank
rapD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rapD

response regulator aspartate phosphatase, controls [protein|search|ComA ]activity
locus
BSU_36380
pI
7.69
mw
41.98 kDa
protein length
354 aa Sequence Blast
gene length
1065 bp Sequence Blast
function
control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]-dependent gene expression
product
response regulator aspartate phosphatase
essential
no
synonyms
ywpA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.2|Response regulator aspartate phosphatase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    3,744,349 3,745,413

    The protein

    Catalyzed reaction/ biological activity

  • control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]-dependent gene expression [Pubmed|17227471]
  • Protein family

  • [SW|RAP family] (according to UniProt)
  • [SW|Domains]

  • six [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
  • Structure

  • [PDB|4I9E] ([protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|RapF], 26% identity) [pubmed|23526880]
  • Expression and Regulation

    Operons

    genes
    [gene|4670F7C4CB9084A5BA478CAE238FA0F8C39F3A7E|rapD]
    description
    [Pubmed|9636707]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9636707], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|9636707], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR]: repression, [Pubmed|17227471], in [regulon|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR regulon]
  • regulation

  • repressed by [protein|search|RghR] [Pubmed|17227471]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A079 (rapD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/79 NBRP B. subtilis, Japan]
  • BKE36380 ([gene|4670F7C4CB9084A5BA478CAE238FA0F8C39F3A7E|rapD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCCTACCTCTTTGCT, downstream forward: _UP4_TGATTGAAAAACGCCCATTT
  • BKK36380 ([gene|4670F7C4CB9084A5BA478CAE238FA0F8C39F3A7E|rapD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCCTACCTCTTTGCT, downstream forward: _UP4_TGATTGAAAAACGCCCATTT
  • References

  • 17227471,9636707,18179421,23526880