SubtiBank SubtiBank
yxiH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxiH

unknown
locus
BSU_39180
pI
6.92
mw
12.30 kDa
protein length
109 aa Sequence Blast
gene length
330 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,020,977 4,021,306

    Biological materials

    Mutant

  • MGNA-B793 (yxiH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1792 NBRP B. subtilis, Japan]
  • BKE39180 ([gene|460A5DAAA8480FE0FF8DBA52F333AE2ECB62E5CA|yxiH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGTTATGCTCCTAGGT, downstream forward: _UP4_TAGAAACAACAGCTTTGGGT
  • BKK39180 ([gene|460A5DAAA8480FE0FF8DBA52F333AE2ECB62E5CA|yxiH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGTTATGCTCCTAGGT, downstream forward: _UP4_TAGAAACAACAGCTTTGGGT