SubtiBank SubtiBank
comFA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

comFA

membrane-associated DNA-dependent ATPase, may provide energy for DNA transport
locus
BSU35470
pI
9.82
mw
52.40 kDa
protein length
463 aa Sequence Blast
gene length
1392 bp Sequence Blast
function
genetic competence
product
ATP-binding protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,642,167 3,643,558

    Phenotypes of a mutant

  • knockout has 1000-fold reduction in transformability compared to the wild-type [Pubmed|8412657]
  • The protein

    Protein family

  • [SW|helicase family] (according to UniProt)
  • Modification

  • phosphorylated on Arg-20, Arg-186, and Arg-446 [Pubmed|22517742]
  • [SW|Cofactors]

  • Zn2+ [pubmed|28559293]
  • [SW|Localization]

  • cell membrane [Pubmed|7984101]
  • localizes to cell poles in competent cells [Pubmed|16009133]
  • localizes to cell poles [Pubmed|21278288]
  • Expression and Regulation

    Operons

    genes
    [gene|45F27C0789199626BA90D2C69E8F13525C911478|comFA]-[gene|D290247A43280532947B707F3AF388D7A7F404D3|comFB]-[gene|04D9D70C0BCFDCBD00B5156908C348135080A9C2|comFC]-[gene|049B1EBF64F0EBC04CE6D529C8EDB0B6B2184DF5|yvyF]-[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]-[gene|E5A59D2AF53FA220BA98D9653589A8F0D24F75B8|yviE]-[gene|6A6CBD75DCC33C804F853F47D37773930D398CFE|fliW]-[gene|93F328524989597C7D2329B25E665496C9631E87|csrA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8412657], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8045879], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8412657], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|21736639], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19898538], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE35470 ([gene|45F27C0789199626BA90D2C69E8F13525C911478|comFA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATAGCACGCCTCCTTTC, downstream forward: _UP4_TAGCCATTATTTGAAAACGT
  • BKK35470 ([gene|45F27C0789199626BA90D2C69E8F13525C911478|comFA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATAGCACGCCTCCTTTC, downstream forward: _UP4_TAGCCATTATTTGAAAACGT
  • References

    Reviews

  • 15083159
  • Original publications

  • 11814663,8412657,7984101,16009133,8045895,17630974,21278288,22517742,21397556,28559293,28618091