SubtiBank SubtiBank
comFA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

comFA

membrane-associated DNA-dependent ATPase, may provide energy for DNA transport
locus
BSU_35470
pI
9.82
mw
52.40 kDa
protein length
463 aa Sequence Blast
gene length
1392 bp Sequence Blast
function
genetic competence
product
ATP-binding protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,642,167 3,643,558

    Phenotypes of a mutant

  • knockout has 1000-fold reduction in transformability compared to the wild-type [Pubmed|8412657]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O --> ADP + H+ + phosphate (according to UniProt)
  • Protein family

  • [SW|helicase family] (according to UniProt)
  • [SW|Domains]

  • [SW|Helicase ATP-binding domain] (aa 133-285) (according to UniProt)
  • [SW|Helicase C-terminal domain] (aa 317-463) (according to UniProt)
  • Modification

  • phosphorylated on Arg-20, Arg-186, and Arg-446 [Pubmed|22517742]
  • [SW|Cofactors]

  • Zn2+ [pubmed|28559293]
  • [SW|Localization]

  • cell membrane [Pubmed|7984101]
  • localizes to cell poles in competent cells [Pubmed|16009133]
  • localizes to cell poles [Pubmed|21278288]
  • Expression and Regulation

    Operons

    genes
    [gene|45F27C0789199626BA90D2C69E8F13525C911478|comFA]-[gene|D290247A43280532947B707F3AF388D7A7F404D3|comFB]-[gene|04D9D70C0BCFDCBD00B5156908C348135080A9C2|comFC]-[gene|049B1EBF64F0EBC04CE6D529C8EDB0B6B2184DF5|yvyF]-[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]-[gene|E5A59D2AF53FA220BA98D9653589A8F0D24F75B8|yviE]-[gene|6A6CBD75DCC33C804F853F47D37773930D398CFE|fliW]-[gene|93F328524989597C7D2329B25E665496C9631E87|csrA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8412657], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8045879], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8412657], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|21736639], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19898538], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE35470 ([gene|45F27C0789199626BA90D2C69E8F13525C911478|comFA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATAGCACGCCTCCTTTC, downstream forward: _UP4_TAGCCATTATTTGAAAACGT
  • BKK35470 ([gene|45F27C0789199626BA90D2C69E8F13525C911478|comFA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATAGCACGCCTCCTTTC, downstream forward: _UP4_TAGCCATTATTTGAAAACGT
  • References

    Reviews

  • 15083159
  • Original publications

  • 11814663,8412657,7984101,16009133,8045895,17630974,21278288,22517742,21397556,28559293,28618091