SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to magnesium exporter
48.82 kDa
protein length
434 aa Sequence Blast
gene length
1305 bp Sequence Blast

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW|Magnesium uptake/ efflux]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,718,959 2,720,263

    The protein

    Protein family

  • [SW|UPF0053 family](according to UniProt)
  • Paralogous protein(s)

  • [protein|A459410312A926365B45CEB4694DE399B38820A2|YugS], [protein|B2E9D026B668C8530C406353E3400059388566FB|YhdT], [protein|BE0777DE7C40825D4DB7252EA84AAB3892578529|YhdP], [protein|E53B8D437B848B637AEC8C1BB9428EC8B6EB280E|YqhB]
  • [SW|Domains]

  • [SW|CNNM transmembrane domain] (aa 1-201) (according to UniProt)
  • [SW|DUF21 domain] (5-201)
  • 2 [SW|CBS domain]s (aa 220-282, aa 289-346) (according to UniProt)
  • Structure

  • [PDB|4HG0] (CorC from E. coli, corresponds to the [SW|CBS domain]s and the C-terminal transporter-associated domain)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE26610 ([gene|45F03AB13292BBF0554785C7C02FE29033EDD742|yrkA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGATTTGCCTTACCTAG, downstream forward: _UP4_TAACATCTGGATAAAACACA
  • BKK26610 ([gene|45F03AB13292BBF0554785C7C02FE29033EDD742|yrkA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGATTTGCCTTACCTAG, downstream forward: _UP4_TAACATCTGGATAAAACACA
  • Expression vectors

  • pGP2932 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 27933050,31415562