SubtiBank SubtiBank
yuzK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yuzK

unknown
locus
BSU_32719
pI
9.16
mw
5.40 kDa
protein length
gene length
138 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms
bsrI

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • [category|SW 6|Groups of genes] → [category|SW 6.9|NcRNA] → [category|SW 6.9.7|Small RNAs with unknown functions]
  • Gene

    Coordinates
    3,360,974 3,361,111

    Expression and Regulation

    Operons

    genes
    [gene|45ECDC92989453F01CD1A4D12DCFAB9807454338|yuzK]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|9CC242C837A8C3F4D6842DD0843C561C34574856|yurZ]-[gene|45ECDC92989453F01CD1A4D12DCFAB9807454338|yuzK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE32719 ([gene|45ECDC92989453F01CD1A4D12DCFAB9807454338|yuzK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32719 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGACGTATAATCGA, downstream forward: _UP4_TGAGAAAATCAATCTTTTAA
  • BKK32719 ([gene|45ECDC92989453F01CD1A4D12DCFAB9807454338|yuzK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32719 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGACGTATAATCGA, downstream forward: _UP4_TGAGAAAATCAATCTTTTAA
  • GP2574 ([gene|45ECDC92989453F01CD1A4D12DCFAB9807454338|yuzK]::tet comIQ12L) (in DK1042) available in [SW|Jörg Stülke]'s lab