SubtiBank SubtiBank
ydzW/4
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ydzW/4

putative phosphomannomutase, internal part of YdzW
locus
BSU_06077
pI
0.00
mw
0.00 kDa
protein length
gene length
144 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms
Outlinks

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.5|Prophage 3]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    658,615 658,758

    Biological materials

    Mutant

  • BKE06077 ([gene|45E3AAC008A361BAC25A08808B5FBF835DF03F09|ydzW/4]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06077 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCAGTAGATTTGCTGT, downstream forward: _UP4_AAGGCAGCAAATTGACGCCG
  • BKK06077 ([gene|45E3AAC008A361BAC25A08808B5FBF835DF03F09|ydzW/4]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06077 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCAGTAGATTTGCTGT, downstream forward: _UP4_AAGGCAGCAAATTGACGCCG