SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


multidrug-efflux transporter
57.78 kDa
protein length
541 aa Sequence Blast
gene length
1626 bp Sequence Blast
multidrug resistance
multidrug-efflux transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Carbohydrate transporter]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,374,956 3,376,581

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|EmrB family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt), membrane associated [Pubmed|18763711]
  • Expression and Regulation



    regulatory mechanism

  • [protein|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|MdtR]: repression, [Pubmed|19286808], in [regulon|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|MdtR regulon]
  • view in new tab

    Biological materials


  • MGNA-A601 (yusP::erm), available at the [ NBRP B. subtilis, Japan]
  • BP70 (spc) available in [SW|Fabian Commichau]'s lab
  • BKE32880 ([gene|45C61C1584A851676F15A2249F3F1092863C5AA5|mdtP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGTTTGCCTTCTTTACTCA, downstream forward: _UP4_TAATAGAGCACCCCGCGGGT
  • BKK32880 ([gene|45C61C1584A851676F15A2249F3F1092863C5AA5|mdtP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGTTTGCCTTCTTTACTCA, downstream forward: _UP4_TAATAGAGCACCCCGCGGGT
  • References

  • 18763711,19286808