SubtiBank SubtiBank
mdtP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mdtP

multidrug-efflux transporter
locus
BSU_32880
pI
9.84
mw
57.78 kDa
protein length
541 aa Sequence Blast
gene length
1626 bp Sequence Blast
function
multidrug resistance
product
multidrug-efflux transporter
essential
no
synonyms
yusP

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.3|Carbohydrate transporter]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,374,956 3,376,581

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|EmrB family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt), membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|mdtR]-[gene|45C61C1584A851676F15A2249F3F1092863C5AA5|mdtP]
    description
    [Pubmed|19286808]

    regulatory mechanism

  • [protein|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|MdtR]: repression, [Pubmed|19286808], in [regulon|795D70E8A4D750140D6B1AA4BFEBD25C2A389C85|MdtR regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A601 (yusP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/601 NBRP B. subtilis, Japan]
  • BP70 (spc) available in [SW|Fabian Commichau]'s lab
  • BKE32880 ([gene|45C61C1584A851676F15A2249F3F1092863C5AA5|mdtP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGTTTGCCTTCTTTACTCA, downstream forward: _UP4_TAATAGAGCACCCCGCGGGT
  • BKK32880 ([gene|45C61C1584A851676F15A2249F3F1092863C5AA5|mdtP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGTTTGCCTTCTTTACTCA, downstream forward: _UP4_TAATAGAGCACCCCGCGGGT
  • References

  • 18763711,19286808