SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


spore coat protein, similar to chloride peroxidase
30.41 kDa
protein length
268 aa Sequence Blast
gene length
807 bp Sequence Blast
protection of the spore
spore coat protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Class III]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    1,169,043 1,169,849

    The protein

    Protein family

  • [SW|AB hydrolase superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|AB hydrolase-1 domain] (aa 23-254) (according to UniProt)
  • Structure

  • [PDB|5H3H] (from ''Exiguobacterium Antarcticum'', 52% identity)
  • [SW|Localization]

  • inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|22171814]
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|12480901], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|12480901]
  • view in new tab

    Biological materials


  • MGNA-A501 (yisY::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10900 ([gene|4591A235A80605E546EBC187038A6B88C129ADC9|yisY]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGCATTCCTCCTGTT, downstream forward: _UP4_TAAGAAAAAACCCGACATTG
  • BKK10900 ([gene|4591A235A80605E546EBC187038A6B88C129ADC9|yisY]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGCATTCCTCCTGTT, downstream forward: _UP4_TAAGAAAAAACCCGACATTG
  • References

  • 12480901,22171814,15383836