SubtiBank SubtiBank
yisY
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yisY

spore coat protein, similar to chloride peroxidase
locus
BSU_10900
pI
6.89
mw
30.41 kDa
protein length
268 aa Sequence Blast
gene length
807 bp Sequence Blast
function
protection of the spore
product
spore coat protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.3|Class III]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,169,043 1,169,849

    The protein

    Protein family

  • [SW|AB hydrolase superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|AB hydrolase-1 domain] (aa 23-254) (according to UniProt)
  • Structure

  • [PDB|5H3H] (from ''Exiguobacterium Antarcticum'', 52% identity)
  • [SW|Localization]

  • inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|4591A235A80605E546EBC187038A6B88C129ADC9|yisY]
    description
    [Pubmed|12480901]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|12480901], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|12480901]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A501 (yisY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/501 NBRP B. subtilis, Japan]
  • BKE10900 ([gene|4591A235A80605E546EBC187038A6B88C129ADC9|yisY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGCATTCCTCCTGTT, downstream forward: _UP4_TAAGAAAAAACCCGACATTG
  • BKK10900 ([gene|4591A235A80605E546EBC187038A6B88C129ADC9|yisY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGCATTCCTCCTGTT, downstream forward: _UP4_TAAGAAAAAACCCGACATTG
  • References

  • 12480901,22171814,15383836