SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


PBSX phage RNA polymerase sigma factor
19.95 kDa
protein length
169 aa Sequence Blast
gene length
510 bp Sequence Blast
transcription of PBSX prophage genes
PBSX prophage RNA polymerase sigma factor
pcf, ykxE

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Sigma factors]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • Gene

    1,324,471 1,324,980

    Biological materials


  • BKE12560 ([gene|458406A4E6824C24493CFC19718F10720AA3B453|xpf]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATGATCCTCCTCAT, downstream forward: _UP4_TGAAAGCTTGTCATACGTTT
  • BKK12560 ([gene|458406A4E6824C24493CFC19718F10720AA3B453|xpf]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATGATCCTCCTCAT, downstream forward: _UP4_TGAAAGCTTGTCATACGTTT
  • References

  • 8083174