SubtiBank SubtiBank
ywcB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywcB

unknown
locus
BSU_38230
pI
9.94
mw
11.58 kDa
protein length
102 aa Sequence Blast
gene length
309 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ipa-32r

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,923,920 3,924,228

    Phenotypes of a mutant

  • ''ywcBA'' mutant has slightly reduced acetic acid transport [Pubmed|26060272]
  • ''ywcBA'' mutant shows earlier pellicle biofilm formation [Pubmed|26060272]
  • The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|4583EA9A4DF9F9EC054437CFB1C3849EA7BD49FA|ywcB]-[gene|ADB447B0F8EA4F341FA48344AA958E6B98B9EFE4|ywcA]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE]) [Pubmed|15699190]
  • view in new tab

    Biological materials

    Mutant

  • BKE38230 ([gene|4583EA9A4DF9F9EC054437CFB1C3849EA7BD49FA|ywcB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCTTTCCTCCTTTTAT, downstream forward: _UP4_GAGGATCTGAAGGGTGAACA
  • BKK38230 ([gene|4583EA9A4DF9F9EC054437CFB1C3849EA7BD49FA|ywcB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCTTTCCTCCTTTTAT, downstream forward: _UP4_GAGGATCTGAAGGGTGAACA
  • References

  • 26060272,15699190