SubtiBank SubtiBank
ytsJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ytsJ

malic enzyme, forms a transhydrogenation cycle with [protein|search|MalS ]for balancing of NADPH
locus
BSU_29220
pI
5.05
mw
43.51 kDa
protein length
410 aa Sequence Blast
gene length
1233 bp Sequence Blast
function
malate utilization
product
NADP-dependent malate dehydrogenase
essential
no
ec
1.1.1.38
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    2,989,900 2,991,132

    Phenotypes of a mutant

  • Poor growth with malate as single carbon source [Pubmed|16788182]
  • The protein

    Catalyzed reaction/ biological activity

  • (S)-malate + NAD+ --> CO2 + NADH + pyruvate (according to UniProt)
  • H+ + oxaloacetate --> CO2 + pyruvate (according to UniProt)
  • Protein family

  • [SW|malic enzymes family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|BBBCD5F56779895189E21076AF165B901F654534|MalS], [protein|160EBB7885D7C7FD30A6E35605A862C156E2DA80|MleA]
  • Modification

  • phosphorylated on Arg-27 [Pubmed|31221751]
  • [SW|Cofactors]

  • NADP+
  • Structure

  • [PDB|1WW8] (from ''Pyrococcus horikoshii'', 46% identity, 63% similarity)
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|ytsJ]
    description
    [Pubmed|9387221]
    view in new tab

    genes
    [gene|65B5EA4DBDF5B260DED754B8A7B226AA88F17B55|dnaE]-[gene|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|ytsJ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [PubMed|14593098,16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [http://www.ncbi.nlm.nih.gov/sites/entrez/14593098,16267290 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A176 (ytsJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/176 NBRP B. subtilis, Japan]
  • GP612 (spc), available in [SW|Jörg Stülke]'s lab
  • GP1143 (spc), available in [SW|Jörg Stülke]'s lab
  • BKE29220 ([gene|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|ytsJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCTAAACACTCCTT, downstream forward: _UP4_TAATTTTAATTCATTCCAAA
  • BKK29220 ([gene|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|ytsJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCTAAACACTCCTT, downstream forward: _UP4_TAATTTTAATTCATTCCAAA
  • GFP fusion

  • GP1432 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1131 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab [pubmed|20933603]
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References

  • 16479537,16788182,12949160,9387221,23136871,22740702,15378759,31221751