SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


malic enzyme, forms a transhydrogenation cycle with [protein|search|MalS ]for balancing of NADPH
43.51 kDa
protein length
410 aa Sequence Blast
gene length
1233 bp Sequence Blast
malate utilization
NADP-dependent malate dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,989,900 2,991,132

    Phenotypes of a mutant

  • Poor growth with malate as single carbon source [Pubmed|16788182]
  • The protein

    Catalyzed reaction/ biological activity

  • (S)-malate + NAD+ --> CO2 + NADH + pyruvate (according to UniProt)
  • H+ + oxaloacetate --> CO2 + pyruvate (according to UniProt)
  • Protein family

  • [SW|malic enzymes family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|BBBCD5F56779895189E21076AF165B901F654534|MalS], [protein|160EBB7885D7C7FD30A6E35605A862C156E2DA80|MleA]
  • Modification

  • phosphorylated on Arg-27 [Pubmed|31221751]
  • [SW|Cofactors]

  • NADP+
  • Structure

  • [PDB|1WW8] (from ''Pyrococcus horikoshii'', 46% identity, 63% similarity)
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation


    view in new tab


    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [PubMed|14593098,16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [,16267290 PubMed]
  • view in new tab

    Biological materials


  • MGNA-A176 (ytsJ::erm), available at the [ NBRP B. subtilis, Japan]
  • GP612 (spc), available in [SW|Jörg Stülke]'s lab
  • GP1143 (spc), available in [SW|Jörg Stülke]'s lab
  • BKE29220 ([gene|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|ytsJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCTAAACACTCCTT, downstream forward: _UP4_TAATTTTAATTCATTCCAAA
  • BKK29220 ([gene|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|ytsJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCTAAACACTCCTT, downstream forward: _UP4_TAATTTTAATTCATTCCAAA
  • GFP fusion

  • GP1432 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1131 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab [pubmed|20933603]
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References

  • 16479537,16788182,12949160,9387221,23136871,22740702,15378759,31221751