SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


large subunit of glutamate synthase
168.61 kDa
protein length
1520 aa Sequence Blast
gene length
4563 bp Sequence Blast
glutamate biosynthesis
glutamate synthase (large subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,010,070 2,014,632

    Phenotypes of a mutant

  • auxotrophic for glutamate
  • The protein

    Catalyzed reaction/ biological activity

  • 2 L-glutamate + NADP+ --> 2-oxoglutarate + H+ + L-glutamine + NADPH (according to UniProt)
  • Protein family

  • glutamate synthase family (with [protein|D1AF9DA2594D2E2A94DC207A870C8495954A7A17|YerD] and [protein|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|GltB], according to UniProt)
  • Paralogous protein(s)

  • [protein|D1AF9DA2594D2E2A94DC207A870C8495954A7A17|YerD]
  • [SW|Domains]

  • [SW|Glutamine amidotransferase type-2 domain] (aa 22-415) (according to UniProt)
  • Nucleotide binding domain (1060-1112)
  • Modification

  • phosphorylated on Arg-904 AND/OR Arg-914 [Pubmed|22517742]
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • FAD (according to UniProt)
  • Structure

  • [PDB|2VDC] (the [protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|GltA]-[protein|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|GltB] complex of ''Azospirillum brasiliense'') [Pubmed|18199747]
  • [SW|Localization]

  • membrane associated [pubmed|18763711], cytoplasm (according to UniProt)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • [SW|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [Pubmed|23239624,23239623]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2548995], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|11029411], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC]: activation, [Pubmed|2548995], in [regulon|87BCAE725B02860156D50E1783F6DB68510C811E|GltC regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: indirect effect, in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • expressed in the presence of ammonium [Pubmed|11029411]
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation inhibition, [Pubmed|22389480]
  • Biological materials


  • BP123 (Δ[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]::''ermC'') , available in [SW|Fabian Commichau]'s lab
  • GP807 (Δ[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]::''tet'') , available in [SW|Jörg Stülke]'s lab
  • GP222 (''gltA'' under the control of p-xyl), available in [SW|Jörg Stülke]'s lab
  • 1A808 ( ''gltA''::''cat''), [Pubmed|15109830], available at [ BGSC]
  • 1A809 ( ''gltA''::''kan''), [Pubmed|15109830], available at [ BGSC]
  • BKE18450 ([gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTCCTCTCCCCCGAT, downstream forward: _UP4_GTACAGTAAGGAAGGGGAGA
  • BKK18450 ([gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTCCTCTCCCCCGAT, downstream forward: _UP4_GTACAGTAAGGAAGGGGAGA
  • lacZ fusion

  • pGP526 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab [pubmed|14523131]
  • pGP919 (in [SW|pAC5]), available in [SW|Jörg Stülke]'s lab [pubmed|17183217]
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [ Homepage]
  • [SW|Jörg Stülke], University of Göttingen, Germany [ Homepage]
  • [SW|Fabian Commichau] Brandenburg Technical University Cottbus-Senftenberg, Germany [ Homepage]
  • References


  • 16143852,12859215,22625175,12859215
  • Original publications

  • 12823818,18199747,11029411,12850135,7559360,15150225,2548995,17183217,17608797,17134717,14523131,12823818,18326565,17981983,18763711,20933603,17012385,22389480,22517742,25755103,28294562,28386026,29242163,11967268,31649652,32393519