SubtiBank SubtiBank
rplA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rplA

ribosomal protein
locus
BSU_01030
pI
9.73
mw
24.77 kDa
protein length
232 aa Sequence Blast
gene length
699 bp Sequence Blast
function
translation
product
ribosomal protein L1 (BL1)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • Gene

    Coordinates
    119,111 119,809

    Phenotypes of a mutant

  • slow growth, this can be suppressed by inactivation of [gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|yhdP] [pubmed|29967120]
  • reduced sporulation frequency, this can be suppressed by inactivation of [gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|yhdP] [pubmed|29967120]
  • The protein

    Protein family

  • universal [SW|ribosomal protein] uL1 family (single member, according to UniProt)
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • [SW|Localization]

  • [SW|ribosome] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|F94A1C14912F35ADB4C611AA17D55268CC26160D|rplK]-[gene|44D4CE353E1E532664A508CBE8B49AC8BB861B53|rplA]-[gene|E4D89640D0F0A31A2814D20FB5425FDB0B46A43D|BSU_misc_RNA_3]-[gene|5EF3A7953AA97D2B44C967542A53FEA7F36D7BA3|rplJ]-[gene|E72910604D3DC2A62AE8A951F55570EA2838B250|rplL]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, [pubmed|11948165], in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Biological materials

    Mutant

  • BKE01030 ([gene|44D4CE353E1E532664A508CBE8B49AC8BB861B53|rplA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAAAATTTCCTCCTT, downstream forward: _UP4_TAATATTGACATGACATCAA
  • BKK01030 ([gene|44D4CE353E1E532664A508CBE8B49AC8BB861B53|rplA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAAAATTTCCTCCTT, downstream forward: _UP4_TAATATTGACATGACATCAA
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1094 (erm, based on [SW|pGP1087]), available in [SW|Jörg Stülke]'s lab
  • References

  • 17981968,19653700,11463749,22848659,23175651,23002217,25903689,29967120