SubtiBank SubtiBank
seaA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

seaA

involved in spore envelope assembly
locus
BSU_22850
pI
6.24
mw
32.78 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
function
involved in spore envelope assembly
product
unknown
essential
no
synonyms
yphB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,391,861 2,392,754

    Expression and Regulation

    Operons

    genes
    [gene|5DA8B27AC6A0E0B4115512BD948C31964D387A8E|yphA]-[gene|448375DF74EB0482A6CD1ACFE04D117C1319E2B2|seaA]
    description
    [Pubmed|15699190,8759874]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190,8759874], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|15699190,8759874]
  • view in new tab

    genes
    [gene|5DA8B27AC6A0E0B4115512BD948C31964D387A8E|yphA]-[gene|448375DF74EB0482A6CD1ACFE04D117C1319E2B2|seaA]-[gene|910109496E4A41EC892996DEEB81971FCBD9CB05|ypzH]-[gene|B2270316642C66BC2DA86EBDCD1BF6A33CC6A1DC|yphC]-[gene|8440C1DBE485BB9EF2904FAA5D709A574C3819A4|gpsA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A401 (yphB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/401 NBRP B. subtilis, Japan]
  • BKE22850 ([gene|448375DF74EB0482A6CD1ACFE04D117C1319E2B2|seaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATAATCGGATAGATGTAAT, downstream forward: _UP4_AAGAATCAGGATAAGGTGAT
  • BKK22850 ([gene|448375DF74EB0482A6CD1ACFE04D117C1319E2B2|seaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATAATCGGATAGATGTAAT, downstream forward: _UP4_AAGAATCAGGATAAGGTGAT
  • References

  • 15699190,8759874