SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


involved in spore envelope assembly
32.78 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
involved in spore envelope assembly

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    2,391,861 2,392,754

    Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190,8759874], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|15699190,8759874]
  • view in new tab

    view in new tab

    Biological materials


  • MGNA-A401 (yphB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE22850 ([gene|448375DF74EB0482A6CD1ACFE04D117C1319E2B2|seaA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATAATCGGATAGATGTAAT, downstream forward: _UP4_AAGAATCAGGATAAGGTGAT
  • BKK22850 ([gene|448375DF74EB0482A6CD1ACFE04D117C1319E2B2|seaA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATAATCGGATAGATGTAAT, downstream forward: _UP4_AAGAATCAGGATAAGGTGAT
  • References

  • 15699190,8759874