SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


phosphoribosylaminoimidazole succinocarboxamide synthase
27.31 kDa
protein length
241 aa Sequence Blast
gene length
726 bp Sequence Blast
purine biosynthesis
phosphoribosylaminoimidazole succinocarboxamide synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    701,601 702,326

    The protein

    Catalyzed reaction/ biological activity

  • 5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxylate + ATP + L-aspartate --> (2S)-2-[5-amino-1-(5-phospho-β-D-ribosyl)imidazole-4-carboxamido]succinate + ADP + 2 H+ + phosphate (according to UniProt)
  • Protein family

  • SAICAR synthetase family (according to Swiss-Prot)
  • Structure

  • [PDB|1KUT] (from ''Thermotoga maritima'', 40% identity, 57% similarity) [Pubmed|16582479]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials


  • BKE06450 ([gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGGAAGGCCTCCTAACCC, downstream forward: _UP4_TTCAATAGACTGGGAGGCAT
  • BKK06450 ([gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGGAAGGCCTCCTAACCC, downstream forward: _UP4_TTCAATAGACTGGGAGGCAT
  • References

  • 12884008,3036807,12923093,7638212,15378759