SubtiBank SubtiBank
purC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

purC

phosphoribosylaminoimidazole succinocarboxamide synthase
locus
BSU06450
pI
4.88
mw
27.31 kDa
protein length
241 aa Sequence Blast
gene length
726 bp Sequence Blast
function
purine biosynthesis
product
phosphoribosylaminoimidazole succinocarboxamide synthase
essential
no
ec
6.3.2.6
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    Coordinates
    701,601 702,326

    The protein

    Catalyzed reaction/ biological activity

  • ATP 5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxylate L-aspartate = ADP phosphate (S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate (according to Swiss-Prot)
  • Protein family

  • SAICAR synthetase family (according to Swiss-Prot)
  • Structure

  • [PDB|1KUT] (from ''Thermotoga maritima'', 40% identity, 57% similarity) [Pubmed|16582479]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]-[gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]-[gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]-[gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]-[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]-[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]-[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]-[gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]-[gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]-[gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]-[gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]-[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]
    description
    [Pubmed|3036807]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials

    Mutant

  • BKE06450 ([gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGGAAGGCCTCCTAACCC, downstream forward: _UP4_TTCAATAGACTGGGAGGCAT
  • BKK06450 ([gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGGAAGGCCTCCTAACCC, downstream forward: _UP4_TTCAATAGACTGGGAGGCAT
  • References

  • 12884008,3036807,12923093,7638212,15378759