SubtiBank SubtiBank
yoaP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yoaP

unknown
locus
BSU_18690
pI
7.81
mw
28.70 kDa
protein length
251 aa Sequence Blast
gene length
756 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,039,610 2,040,365

    The protein

    Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 4-152) (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-A843 (yoaP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/843 NBRP B. subtilis, Japan]
  • BKE18690 ([gene|442B65B46DBF5070F4DCD6DA9014C8A8927EF726|yoaP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCCTCTTTCCCCCCTT, downstream forward: _UP4_TGATTTTTAATAATAAAAAG
  • BKK18690 ([gene|442B65B46DBF5070F4DCD6DA9014C8A8927EF726|yoaP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCCTCTTTCCCCCCTT, downstream forward: _UP4_TGATTTTTAATAATAAAAAG