SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


28.70 kDa
protein length
251 aa Sequence Blast
gene length
756 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,039,610 2,040,365

    The protein

    Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 4-152) (according to UniProt)
  • Biological materials


  • MGNA-A843 (yoaP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18690 ([gene|442B65B46DBF5070F4DCD6DA9014C8A8927EF726|yoaP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCCTCTTTCCCCCCTT, downstream forward: _UP4_TGATTTTTAATAATAAAAAG
  • BKK18690 ([gene|442B65B46DBF5070F4DCD6DA9014C8A8927EF726|yoaP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCCTCTTTCCCCCCTT, downstream forward: _UP4_TGATTTTTAATAATAAAAAG