SubtiBank SubtiBank
yqjT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqjT

unknown
locus
BSU_23750
pI
7.79
mw
15.05 kDa
protein length
128 aa Sequence Blast
gene length
387 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,468,159 2,468,545

    The protein

    [SW|Domains]

  • [SW|VOC domain] (aa 1-126) (according to UniProt)
  • Structure

  • [PDB|3CT8] (from B. halodurans, 60% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|35B40D812B123766B469B8E5C0FE0EB69F671E4E|yqjP]-[gene|0927C7D45721F47F5ED2646CAAC324A308FD7724|yqjQ]-[gene|4E7390A74A8261E8B732E94859E90FE256AD64EE|dsdA]-[gene|B3362449EF3C9D533090FBD7E7333A3CC5D902CB|coaA]-[gene|441DCE4251C83FCBB01BC58720900365BFE7BB3D|yqjT]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C400 (yqjT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2398 NBRP B. subtilis, Japan]
  • BKE23750 ([gene|441DCE4251C83FCBB01BC58720900365BFE7BB3D|yqjT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACAGTTCAATATGATGCA, downstream forward: _UP4_GTAGAGCTCGTTGCCCCAAG
  • BKK23750 ([gene|441DCE4251C83FCBB01BC58720900365BFE7BB3D|yqjT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACAGTTCAATATGATGCA, downstream forward: _UP4_GTAGAGCTCGTTGCCCCAAG