SubtiBank SubtiBank
gmuA
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

gmuA

glucomannan-specific phosphotransferase system, EIIA component of the PTS
locus
BSU05820
pI
5.63
mw
12.21 kDa
protein length
110 aa Sequence Blast
gene length
330 bp Sequence Blast
function
glucomannan uptake and phosphorylation
product
glucomannan-specific phosphotransferase system, EIIA component
essential
no
synonyms
ydhN

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.25|Utilization of glucomannan]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    626,933 → 627,265

    The protein

    Protein family

  • [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] permease, lactose permease (Lac) family [Pubmed|10627040]
  • Structure

  • [PDB|3K1S] (IIA(Cel) from ''B. anthracis'', 42% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]-[gene|44014896157718D3A6190DFDBD663C5CB9DA63FC|gmuA]-[gene|76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC|gmuC]-[gene|D8C81A8768E9C6B47B5E196B54DC2A3A8256E7E6|gmuD]-[gene|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]-[gene|EB6DE119E6FB18413DB2C2B62B114FB787164F74|gmuE]-[gene|35225776F6044513D3E77DBBD6A7A8FE976F506A|gmuF]-[gene|289ACC9D13BBFAA5C083EE525ECCC32DB06E075F|gmuG]
    description
    [Pubmed|18177310]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18177310], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]: repression, [Pubmed|18177310], in [regulon|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|18177310], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by cellobiose ([protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]) [Pubmed|18177310]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C189 (ydhN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2187 NBRP B. subtilis, Japan]
  • BKE05820 (Δ[gene|44014896157718D3A6190DFDBD663C5CB9DA63FC|gmuA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTGATTCACCATTAA, downstream forward: _UP4_ATATAAAAAATCGGGGTGGA
  • BKK05820 (Δ[gene|44014896157718D3A6190DFDBD663C5CB9DA63FC|gmuA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTGATTCACCATTAA, downstream forward: _UP4_ATATAAAAAATCGGGGTGGA
  • References

  • 18177310,10627040,18177310,20817675