SubtiBank SubtiBank
nusG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

nusG

transcription antitermination and pausing factor
locus
BSU_01010
pI
5.25
mw
19.98 kDa
protein length
177 aa Sequence Blast
gene length
534 bp Sequence Blast
function
transcription
product
sequence-specific RNA polymerase pause factor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.3|Transcription elongation/ termination]
  • Gene

    Coordinates
    117,890 118,423

    The protein

    Catalyzed reaction/ biological activity

  • binds to the non-template DNA within the paused transcription bubble [Pubmed|26742846]
  • shifts [SW|RNA polymerase] to the posttranslocation register and induces pausing at 1,600 sites containing a consensus TTNTTT motif in the nontemplate DNA strand within the paused transcription bubble [pubmed|32817529]
  • [SW|Domains]

  • KOW domain (aa 128-156) (according to UniProt)
  • Structure

  • [PDB|2JVV] (from ''E. coli'', 44% identity) [Pubmed|19500594]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Biological materials

    Mutant

  • GP2633 ([gene|43CFA3477B4EEB4CE0B2DF63ED2B5EDB171E79C7|nusG]::''cat''), available in [SW|Jörg Stülke]'s lab
  • BKE01010 ([gene|43CFA3477B4EEB4CE0B2DF63ED2B5EDB171E79C7|nusG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTCAGGACTGTCC, downstream forward: _UP4_TAATGTGAAAAAACTTGAAA
  • BKK01010 ([gene|43CFA3477B4EEB4CE0B2DF63ED2B5EDB171E79C7|nusG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTCAGGACTGTCC, downstream forward: _UP4_TAATGTGAAAAAACTTGAAA
  • References

    Reviews

  • 24632072,33003953
  • Original publications

  • 18852477,16707701,11101662,10027981,23033921,21040729,20384694,26742846,19500594,29887376,31719185,32817529