SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


may be involved in protection against methyl-hydroquinone
22.29 kDa
protein length
200 aa Sequence Blast
gene length
603 bp Sequence Blast
may be involved in protection against methyl-hydroquinone

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    2,128,464 2,129,066

    The protein

    Protein family

  • [SW|AB hydrolase superfamily] (according to UniProt)
  • Structure

  • [PDB|2H1I] (from B. cereus, 59% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17725564], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR]: repression, [Pubmed|17725564], in [regulon|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR regulon]
  • regulation

  • induced by 2-methylhydroquinone ([protein|search|MhqR]) [Pubmed|17725564]
  • view in new tab

    Biological materials


  • MGNA-B435 (yodD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19560 ([gene|43CD556065D2EF14365C78E014B7B2051CA0C78F|mhqD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGCTTCATTATAAATTCCC, downstream forward: _UP4_TAAAAAAACCTTAGTCCGGA
  • BKK19560 ([gene|43CD556065D2EF14365C78E014B7B2051CA0C78F|mhqD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGCTTCATTATAAATTCCC, downstream forward: _UP4_TAAAAAAACCTTAGTCCGGA
  • References

  • 17407181,17725564