SubtiBank SubtiBank
ypbB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypbB

unknown
locus
BSU_23030
pI
9.15
mw
40.55 kDa
protein length
352 aa Sequence Blast
gene length
1059 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,408,405 2,409,463

    Biological materials

    Mutant

  • MGNA-A394 (ypbB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/394 NBRP B. subtilis, Japan]
  • BKE23030 ([gene|43CAF09C837C662E02FBD632D420C7A1109F29F3|ypbB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACCTATCCACCTACATTC, downstream forward: _UP4_CAATATGACTAAATTACAGC
  • BKK23030 ([gene|43CAF09C837C662E02FBD632D420C7A1109F29F3|ypbB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACCTATCCACCTACATTC, downstream forward: _UP4_CAATATGACTAAATTACAGC
  • References

  • 21170359