SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


general stress protein
16.54 kDa
protein length
152 aa Sequence Blast
gene length
456 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    3,047,107 → 3,047,562

    The protein


  • phosphorylated on Arg-50 [Pubmed|22517742]
  • phosphorylated on Arg-151 [pubmed|31221751]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|8733232,11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|8733232], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|8733232,11544224]
  • view in new tab

    Biological materials


  • MGNA-B528 (ytxH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29770 (Δ[gene|43BF293F735ED783D36F33AA4701D57F2AED6657|ytxH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTATTCCTCCTCTTA, downstream forward: _UP4_TGAGCAGGGAAGGAAGAGCT
  • BKK29770 (Δ[gene|43BF293F735ED783D36F33AA4701D57F2AED6657|ytxH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTATTCCTCCTCTTA, downstream forward: _UP4_TGAGCAGGGAAGGAAGAGCT
  • References

  • 11544224,8733232,22517742,31221751