SubtiBank SubtiBank
ytxH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ytxH

general stress protein
locus
BSU_29770
pI
5.11
mw
16.54 kDa
protein length
152 aa Sequence Blast
gene length
456 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
csb40

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,047,107 → 3,047,562

    The protein

    Modification

  • phosphorylated on Arg-50 [Pubmed|22517742]
  • phosphorylated on Arg-151 [pubmed|31221751]
  • Expression and Regulation

    Operons

    genes
    [gene|00A42FDB559BE2647CD682180420A435E2E7035F|ytxG]-[gene|43BF293F735ED783D36F33AA4701D57F2AED6657|ytxH]-[gene|8B4E1D087B75B5E77BCB60FF3465270CEB72B028|ytxJ]
    description
    [Pubmed|8733232]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|8733232,11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|8733232], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|8733232,11544224]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B528 (ytxH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1527 NBRP B. subtilis, Japan]
  • BKE29770 (Δ[gene|43BF293F735ED783D36F33AA4701D57F2AED6657|ytxH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTATTCCTCCTCTTA, downstream forward: _UP4_TGAGCAGGGAAGGAAGAGCT
  • BKK29770 (Δ[gene|43BF293F735ED783D36F33AA4701D57F2AED6657|ytxH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTATTCCTCCTCTTA, downstream forward: _UP4_TGAGCAGGGAAGGAAGAGCT
  • References

  • 11544224,8733232,22517742,31221751