SubtiBank SubtiBank
ymfF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ymfF

unknown
locus
BSU_16845
pI
5.26
mw
48.00 kDa
protein length
426 aa Sequence Blast
gene length
1281 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,757,037 1,758,317

    The protein

    Protein family

  • [SW|Peptidase M16 family] (according to UniProt)
  • Structure

  • [PDB|3D3Y] (from Enterococcus faecalis, 34% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|11997FE6BA6947E7C7E3DBE20B49C9FB758262B2|ymfD]-[gene|43BADA6A6C8248270A50EB3D81253ECE6C84F03F|ymfF]-[gene|9A5EB7CA38D948007AD788297128035AB4074490|ymfH]
    description
    [Pubmed|18502870]

    regulatory mechanism

  • [protein|A7326377132C670B60695EFE0A652B1E4F623698|Mta]: activation, [Pubmed|18502870], in [regulon|A7326377132C670B60695EFE0A652B1E4F623698|Mta regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B117 (ymfF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1116 NBRP B. subtilis, Japan]
  • BKE16845 ([gene|43BADA6A6C8248270A50EB3D81253ECE6C84F03F|ymfF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16845 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGGAACCTCCTTCGTT, downstream forward: _UP4_TTAAAAGGGACGGAGGGTGC
  • BKK16845 ([gene|43BADA6A6C8248270A50EB3D81253ECE6C84F03F|ymfF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16845 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGGAACCTCCTTCGTT, downstream forward: _UP4_TTAAAAGGGACGGAGGGTGC
  • References

  • 18502870