SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


anti-[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM] protein,required for the perception of cell wall stress signals
10.50 kDa
protein length
gene length
291 bp Sequence Blast
control of [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM] activity
anti-[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM] protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,028,233 1,028,523

    Phenotypes of a mutant

  • small colonies on LB [pubmed|30715747]
  • The protein


  • cell membrane [Pubmed|14993308]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9573210], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|9573210,18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulation

  • induced by glucose [Pubmed|27965645]
  • additional information

  • expression of [protein|search|CsbB] in the absence of [protein|search|YfhO] causes constitutive activation of [protein|search|SigM] [PubMed|23632331]
  • view in new tab

    Biological materials


  • MGNA-A694 (yhdK::erm), available at the [ NBRP B. subtilis, Japan]
  • BP97 (Δ([gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]-[gene|48975EC8FB5B03F136AA112DE2ED9CFD0E9C4141|yhdL]-[gene|43AD66E4AEE951130F134FD720E17DB4D2FF112E|yhdK])::aphA3), available in [SW|Fabian Commichau]'s lab
  • BKE09500 ([gene|43AD66E4AEE951130F134FD720E17DB4D2FF112E|yhdK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACATTGTGTTCTTTAAAAA, downstream forward: _UP4_TAAAAAAGACGCCTTTTCAG
  • BKK09500 ([gene|43AD66E4AEE951130F134FD720E17DB4D2FF112E|yhdK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACATTGTGTTCTTTAAAAA, downstream forward: _UP4_TAAAAAAGACGCCTTTTCAG
  • References


  • 27344142,29343670
  • Original publications

  • 18179421,14993308,9573210,30715747