SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


spore coat protein, involved in germination
18.40 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast
spore coat protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Not yet assigned]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Additional germination proteins]
  • Gene

    2,124,021 2,124,494

    Phenotypes of a mutant

  • mutants respond poorly to multiple germinants, impaired in early stage of germination [Pubmed|17720779]
  • The protein


  • spore coat, first assembled in foci, then spread around the developing spore in a [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE]-dependent manner [Pubmed|17720779]
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|17720779], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|17720779], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|17720779]
  • view in new tab

    Biological materials


  • BKE19490 ([gene|43877BAA7A3CD4F2891B02BD27D7F26BD651B44C|gerT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCTTCACATCCTTTC, downstream forward: _UP4_TAAAAAACGGCCTGCAATCG
  • BKK19490 ([gene|43877BAA7A3CD4F2891B02BD27D7F26BD651B44C|gerT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCTTCACATCCTTTC, downstream forward: _UP4_TAAAAAACGGCCTGCAATCG
  • References

  • 17720779