SubtiBank SubtiBank
gerT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gerT

spore coat protein, involved in germination
locus
BSU_19490
pI
6.34
mw
18.40 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast
function
germination
product
spore coat protein
essential
no
synonyms
yozR

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • Gene

    Coordinates
    2,124,021 2,124,494

    Phenotypes of a mutant

  • mutants respond poorly to multiple germinants, impaired in early stage of germination [Pubmed|17720779]
  • The protein

    [SW|Localization]

  • spore coat, first assembled in foci, then spread around the developing spore in a [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE]-dependent manner [Pubmed|17720779]
  • Expression and Regulation

    Operons

    genes
    [gene|43877BAA7A3CD4F2891B02BD27D7F26BD651B44C|gerT]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|17720779], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|17720779], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|17720779]
  • view in new tab

    Biological materials

    Mutant

  • BKE19490 ([gene|43877BAA7A3CD4F2891B02BD27D7F26BD651B44C|gerT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCTTCACATCCTTTC, downstream forward: _UP4_TAAAAAACGGCCTGCAATCG
  • BKK19490 ([gene|43877BAA7A3CD4F2891B02BD27D7F26BD651B44C|gerT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCTTCACATCCTTTC, downstream forward: _UP4_TAAAAAACGGCCTGCAATCG
  • References

  • 17720779