SubtiBank SubtiBank
msmX
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

msmX

multiple sugar [SW|ABC transporter ](ATP-binding protein)
locus
BSU38810
pI
7.39
mw
41.21 kDa
protein length
365 aa Sequence Blast
gene length
1098 bp Sequence Blast
function
uptake of maltodextrin, melibiose (probably), and galactooligosaccharides
product
multiple sugar [SW|ABC transporter ](ATP-binding protein)
essential
no
synonyms
yxkG

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.21|Utilization of melibiose]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.23|Utilization of starch/ maltodextrin]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.24|Utilization of galactan]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,984,133 3,985,230

    Phenotypes of a mutant

  • no growth with pectin or galactan as single carbon source [pubmed|29240795]
  • The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|3B9331D6755B8253944AB33521BBF2B3EBA4CAEB|YurJ], [protein|3F502A4DCB1DAD7C3F968465B13C35213240515B|OpuBA]
  • Structure

  • [PDB|1G29] (from Thermococcus litoralis, 54% identity) [pubmed|11080142]
  • [SW|Localization]

  • cell membrane (via [protein|8AF43CA410F3381209196E1B9A4FE66D78020793|AraP]-[protein|AE532A8931D516CC676E765D1D1293E73C335D23|AraQ]) and [protein|EA2DD9892C1128ADCD6C8BC61248EBE45339E6D6|MdxF]-[protein|D72CFFE8ED3EC0280AE92C05A136D66ED1F62251|MdxG] [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|9EE268C3DC3C0F2F846DAEB2004222B6F841B9EA|yxkF]-[gene|434F6C546F783503A82D390FD238F05025FC1802|msmX]
    description
    [Pubmed|10746760]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose ([protein|search|CcpA]) [Pubmed|10666464]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B741 (msmX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1740 NBRP B. subtilis, Japan]
  • BKE38810 ([gene|434F6C546F783503A82D390FD238F05025FC1802|msmX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAACATCCCCCTTTGT, downstream forward: _UP4_TAAGATCAAAAAAACCGGAC
  • BKK38810 ([gene|434F6C546F783503A82D390FD238F05025FC1802|msmX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAACATCCCCCTTTGT, downstream forward: _UP4_TAAGATCAAAAAAACCGGAC
  • References

  • 10092453,16672620,10746760,16707683,10666464,22900538,27501980,29240795,11080142,31138628