SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


19.87 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast
control of intracellular polyamine concentrations

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Metabolism of polyamines]
  • Gene

    3,304,743 3,305,261

    The protein

    Catalyzed reaction/ biological activity

  • acetyl-CoA + alkane-α,ω-diamine --> N-acetylalkane-α,ω-diamine + CoA + H+ (according to UniProt)
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 3-172) (according to UniProt)
  • Structure

  • [PDB|1TIQ]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE32150 ([gene|430E15D61FCCA20FAC2BCCF504A12070794372FD|paiA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCGGATTCAGCCCC, downstream forward: _UP4_TAATATTTTTCGAAGGGTGG
  • BKK32150 ([gene|430E15D61FCCA20FAC2BCCF504A12070794372FD|paiA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCGGATTCAGCCCC, downstream forward: _UP4_TAATATTTTTCGAAGGGTGG
  • References

  • 17588214,16210326,11325965,27965289