SubtiBank SubtiBank
paiA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

paiA

spermine/spermidine-N-acetyltransferase
locus
BSU_32150
pI
5.02
mw
19.87 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast
function
control of intracellular polyamine concentrations
product
spermine/spermidine-N-acetyltransferase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.6|Metabolism of polyamines]
  • Gene

    Coordinates
    3,304,743 3,305,261

    The protein

    Catalyzed reaction/ biological activity

  • acetyl-CoA + alkane-α,ω-diamine --> N-acetylalkane-α,ω-diamine + CoA + H+ (according to UniProt)
  • Structure

  • [PDB|1TIQ]
  • Expression and Regulation

    Operons

    genes
    [gene|430E15D61FCCA20FAC2BCCF504A12070794372FD|paiA]-[gene|511CFC625D79AAA8B78809651684E4E409337AFA|paiB]
    description
    [Pubmed|27965289]
    view in new tab

    Biological materials

    Mutant

  • BKE32150 ([gene|430E15D61FCCA20FAC2BCCF504A12070794372FD|paiA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCGGATTCAGCCCC, downstream forward: _UP4_TAATATTTTTCGAAGGGTGG
  • BKK32150 ([gene|430E15D61FCCA20FAC2BCCF504A12070794372FD|paiA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCGGATTCAGCCCC, downstream forward: _UP4_TAATATTTTTCGAAGGGTGG
  • References

  • 17588214,16210326,11325965,27965289