SubtiBank SubtiBank
mtnW
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mtnW

2,3-diketo-5-methylthiopentyl-1-phosphate enolase, Rubisco-like protein
locus
BSU_13590
pI
5.28
mw
44.89 kDa
protein length
414 aa Sequence Blast
gene length
1245 bp Sequence Blast
function
methionine salvage
product
2,3-diketo-5-methylthiopentyl-1-phosphate enolase
essential
no
synonyms
ykrW

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.10|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • Gene

    Coordinates
    1,427,034 1,428,278

    The protein

    Catalyzed reaction/ biological activity

  • 5-methylsulfanyl-2,3-dioxopentyl phosphate --> 2-hydroxy-5-methylsulfanyl-3-oxopent-1-enyl phosphate (according to UniProt)
  • Protein family

  • RuBisCO large chain family (single member, according to UniProt)
  • Structure

  • [PDB|2ZVI] [Pubmed|19690372]
  • Expression and Regulation

    Operons

    genes
    [gene|42D2F9B958F62DFE447A1321E4109D676ECB899C|mtnW]-[gene|91633E6AF9A715166AE05BD7E540463DE352AA20|mtnX]-[gene|337F1E27C2E380DF8DCADE3581F74CFF52AFD224|mtnB]-[gene|C7D9E701B2CA2C9E85D69CAD6E0A45BE590BAED9|mtnD]
    description
    [Pubmed|12022921]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12022921], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • view in new tab

    Biological materials

    Mutant

  • BKE13590 ([gene|42D2F9B958F62DFE447A1321E4109D676ECB899C|mtnW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCAGAGCTCCTTTCAT, downstream forward: _UP4_AAATGGGGAAAGGCTGAAGC
  • BKK13590 ([gene|42D2F9B958F62DFE447A1321E4109D676ECB899C|mtnW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCAGAGCTCCTTTCAT, downstream forward: _UP4_AAATGGGGAAAGGCTGAAGC
  • References

  • 10094622,19279009,12022921,14551435,11914366,12107147,19194007,15102328,19690372,12787499,18039762