SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


2,3-diketo-5-methylthiopentyl-1-phosphate enolase, Rubisco-like protein
44.89 kDa
protein length
414 aa Sequence Blast
gene length
1245 bp Sequence Blast
methionine salvage
2,3-diketo-5-methylthiopentyl-1-phosphate enolase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • Gene

    1,427,034 1,428,278

    The protein

    Catalyzed reaction/ biological activity

  • 5-(methylthio)-2,3-dioxopentyl phosphate = 2-hydroxy-5-(methylthio)-3-oxopent-1-enyl phosphate (according to Swiss-Prot)
  • Protein family

  • Type IV subfamily (according to Swiss-Prot)
  • Structure

  • [PDB|2ZVI] [Pubmed|19690372]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12022921], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • view in new tab

    Biological materials


  • BKE13590 ([gene|42D2F9B958F62DFE447A1321E4109D676ECB899C|mtnW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCAGAGCTCCTTTCAT, downstream forward: _UP4_AAATGGGGAAAGGCTGAAGC
  • BKK13590 ([gene|42D2F9B958F62DFE447A1321E4109D676ECB899C|mtnW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCAGAGCTCCTTTCAT, downstream forward: _UP4_AAATGGGGAAAGGCTGAAGC
  • References

  • 10094622,19279009,12022921,14551435,11914366,12107147,19194007,15102328,19690372,12787499,18039762